Biorad icycler iq5

Two micrograms of total mRNA was used for first-strand cDNA synthesis with AMV reverse transcriptase (Promega, Madison, WI). The mRNA levels of genes of interest were analyzed by Real-time PCR, which was performed with 2x SYBR master mix (Takara, Otsu, Shiga, Japan), using a BIORAD iCycler iQ5 (Bio-Rad, Hercules, CA). The sequences accession of the primers are Cd32 (accession # NM_010187), Socs3 (accession # NM_007707), Cd86 (accession # NM_019388), myc (accession # NM_001177352), Arg-1 (accession # CT010173), Cd206 (accession # NM_008625), GAPDH (accession # AY618199). Gene levels were normalized to that of GAPDH. All samples were run in duplicate.

Total RNA was isolated from TA muscles or C2C12 myoblasts using TRIzol reagent (Thermo Fisher Scientific). Total RNA concentration was determined using Qubit 4 (Thermo Fisher Scientific). Purified RNA (2 μg) was subjected to reverse transcription using Moloney murine leukemia virus reverse transcriptase (Promega). Expression of the gene of interest was determined using SYBR Green-based qRT-PCR (Takara), performed on a BIORAD iCycler iQ5 (Bio-Rad). Primer sequences used for qRT-PCR are listed in Table S3. Gene expression levels were calculated from threshold cycle (Ct) values using the 2^−△△Ct method, with GAPDH as an internal control.

Total RNAs were extracted using the Trizol method according to the manufacturer's protocol (Invitrogen). Two micrograms of purified RNA were used for cDNA synthesis. Reverse transcription of mRNA was accomplished by 2x SYBR Master Mix (Takara), using a BIO‐RAD iCycler iQ5 (Bio‐Rad). Primers used in this study were as follows: ATM, forward 5′‐GCTGCCATACTTGATCCATG‐3′ and reverse TCCGAATTTGCAGGAGTTG; p53, forward 5′‐GTCGTACCCCGATTCAGGTG‐3′ and reverse 5′‐TCTGCACCGTAGTTGAGCAG‐3′; p21, forward 5′‐TTGTCGCTGTCTTGCACTCT‐3′ and reverse 5′‐TTTCGGCCCTGAGATGTTCC‐3′; α‐SMA, forward 5′‐ACTCTCTTCCAGCCATCTTTCA‐3′ and reverse 5′‐ATAGGTGGTTTCGTGGATGC‐3′; collagen I, forward 5′‐GAGCGGAGAGTACTGGATCG‐3′ and reverse 5′‐TACTCGAACGGGAATCCATC‐3′; collagen III, forward 5′‐TCCCCTGGAATCTGTGAATC‐3′ and reverse 5′‐TGAGTCGAATTGGGGAGAAT‐3′; Cxcl1, forward 5′‐ACTCAAGAATGGTCGCGAGG‐3′ and reverse 5′‐ GTGCCATCAGAGCAGTCTGT‐3′; Cxcl12, forward 5′‐GGTGCTCAAACCTGACGGTAA‐3′ and reverse 5′‐CAGACAGAGCAGGGCCTTAT‐3′; Cxcl8, forward 5′‐CAGAGACAGCAGAGCACACA‐3′ and reverse 5′‐GATGGTTCCTTCCGGTGGTT‐3′; VEGF, forward 5′‐GCAGCGACAAGGCAGACTAT‐3′ and reverse 5′‐AATCCCAGAGCACAGACTCC‐3′; and GAPDH, forward 5′‐CCTGGAGAAACCTGCCAAGTATGA‐3′ and reverse 5′‐TTGAAGTCACAGGAGACAACCTGG‐3′. Real‐time polymerase chain reaction (PCR) was performed using the Bio‐Rad iQ5 (Hercules).