Miseq dna sequencing

MiSeq DNA sequencing was performed by Macrogen, using the Illumina 300bpPE. To prepare the library, DNA was isolated from liver, heart, muscle and lung from mice transduced with sgRNA-control- or sgRNA-LCS2-encoding AAVs. Next, we amplified the target region of the Cas9 nuclease with the Pfu DNA polymerase (Promega) adding the Illumina adapters by two PCRs: NGS1_fwd: ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNTGTGACACTGGAGGCAGAAG and NGS1_rev: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCAAGTCCCCATCACTTGGTT for the first PCR, and NGS2_fwd: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and NGS2_rev: CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTC for the second PCR. The N represents random bases and the X the sequence used for the index. Genomic reads in FASTQ format were aligned to the GRCm38.p6 assembly of the mouse genome using BWA v. 0.7.5a-r40520 (link). Then, reads spanning the genomic region putatively affected by the CRISPR/Cas9 action (chr3: 88482555-88482615) were extracted with Samtools v. 1.3.121 (link) and analyzed using in-house Perl scripts. Briefly, these scripts isolate the part of each read spanning the chosen region, highlight small insertions/deletions and output a count of each regional sequence. Then, we analyzed the percentage of the sequences showing regional differences in sgRNA-control- and sgRNA-LCS2-transduced mouse samples.