Rnaios plus

RNA was extracted from jejunum tissues, which were cut into 2 mm size and put in a lapping tube fitted with 500 μL RNAios Plus (Takara), respectively. The tubes were grinded for 1 min and centrifuged at 8,000 g for 10 min at 4°C. After centrifugation, the supernatant was transferred to other tubes and 500 μL RNAios Plus (Takara) was added. Next, 200 μL of chloroform was added and mixed by hand during 15 s and placed at room temperature for 10 min. The tubes were centrifuged at 12,000 g for 15 min at 4°C. After centrifugation, the supernatant (400 μL) containing RNA was transferred to other tubes, then the same volume of isopropanol was added. The tubes were mixed by hand for 15 s and incubated overnight at −20°C. The next day, the tubes were centrifuged at 12,000 g for 20 min at 4°C. The supernatant was discarded, 1 mL of 75% ethanol was added twice and centrifuged at 12,000 g for 10 min at 4°C. Finally, 75% ethanol was discarded and the tubes was dried. The RNA precipitate was dissolved in 20 μL of RNase free water. The CDNA was synthesized by RNA, according to the instructions for the use of manufacturer's enzymes (Takara). Gene expression was assessed with a SYBR master mix (Takara). Relative mRNA expression was calculated using the ΔΔCt method. Primer sequences for real-time RT-PCR were as follows in Table 1.

Total RNAs were extracted by RNAios Plus (9109, Takara) after which reverse transcription was carried out to synthesize cDNA as previously reported [37 (link)]. Quantitative real-time PCR (qRT-PCR) assays were carried out using a LightCycler system (Roche) with a SYBR qPCR Master Mix (Q711, Vazyme). The primers used for qRT-PCR were: 5′- CGGGAGTCCGCAGTCTTA-3′ (sense) and 5′- GCTTGAGGGTCTGAATCTTG -3′ (antisense) for Twist1, 5′- GGCTCCTTCGTCCTTCTCCTCTAC-3’ (sense) and 5′- CCTGGCACTGGTACTTCTTGACATC-3′ (antisense) for Snail (snail family transcriptional repressor 1), 5′-CCTCCTCCATCTGACACCTCCTC-3′ (sense) and 5′- AGGTAATGTGTGGGTCCGAATATGC-3′ (antisense) for Slug (snail family transcriptional repressor 2), 5′- TCTTCACCGTCTCTTTCAGCATCAC-3′ (sense) and 5′-GAGGAGAACTGGTTGCCTGTAATGG-3′ (antisense) for Zeb1 (zinc finger E-box binding homeobox 1), 5′-GGTTGAATCTGACTGACGGCTCTG-3′ (sense) and 5′-TGCCCGACTCCTGGATCACTTC-3′ (antisense) for USP13, 5′- GGGTTGAACCATGAGAAGT-3′ (sense) and 5′- GACTGTGGTCATGAGTCCT-3′ (antisense) for GAPDH (glyceraldehyde-3-phosphate dehydrogenase). Relative mRNA levels were calculated using the 2^−ΔΔCT method [40 (link)] with GAPDH as an internal control.