Long pcr enzyme mix

Viral RNA extraction was performed using TRIzol. For each sample, 250 µl of serum were added to 750 µl of TRIzol (Thermo Fisher Scientific) followed by homogenization and incubation at room temperature for 5 min. Following the manufacturer's protocol, RNA was separated, precipitated and eluted in nuclease-free water. At this point, RNA was used as template for cDNA synthesis using the High Capacity cDNA Archive Kit (Life Technologies) according to the manufacturer's guidance protocol. After cDNA synthesis, viral targets NS5A and NS5B were amplified by the Nested Polymerase Chain Reaction (Nested-PCR) technique using the Long PCR Enzyme Mix (Thermo Fisher Scientific) following the manufacturer's instructions. For NS5B, the entire gene was amplified since RASs are found across the entire protein, and specific primers were designed for this process (Supplementary Table 1). For NS5A, primers from the literature were used to amplify the first 300 nucleotides since NS5A RASs are restricted to the domain I.²⁴ (link)

Isolation and electroporation of porcine fetal fibroblasts (PFF) were performed as previously described (Li et al. 2014 (link); Yang et al. 2016 (link)). The transfected cells were divided into 20 10-cm culture dishes and recovered for 24 h. After cell recovery, 1 mg/mL G418 (Merck) was added to the PFF culture medium. After 8–12 d of selection, G418-resistant colonies were picked and cultured in 24-well plates by using cloning cylinders. Upon 70%–80% confluency, the cell colonies were subcultured, and 10% of each colony was lysed individually in 10 µL of NP-40 lysis buffer (0.45% NP-40 plus 0.6% Proteinase K) for 60 min at 56°C and then for 10 min at 95°C. The lysate was used as a template for PCR screening, which was performed using Long PCR Enzyme Mix (Thermo Scientific), in accordance with the manufacturer's instructions. The positive cell colonies were expanded and cryopreserved in liquid nitrogen for further SCNT.

P. abyssi 16S and 23S rRNA genes were amplified by PCR from P. abyssi genomic DNA, using the Long PCR Enzyme Mix (Thermo Fisher Scientific), and primers (Metabion) 16S-5′Fw (TAATACGACTCACTATAGGGCGTACTCCCTTAATTCCGGTTGATCC, T7 RNA polymerase promoter is underlined), 16S-3′Rv (GATAGGAGGTGATCGAGCCGTAG) and 23S-5′Fw (TAATACGACTCACTATAGGGCTAAGCCGCCCGGTG), 23S-3′Rv (ACAGGACCTCGGGCGAT), respectively. 23S rDNA synthesis reaction contained 4% DMSO, and the ratio of 5′ and 3′ primers was 1:4. 16S rDNA was further used as a template for PCR amplification of fragment 431–533 nt, 856–962 nt, 1320–1512 nt, 16S.5′, 16S.C, and 16.S3′ DNA, using High Fidelity PCR Enzyme Mix (Thermo Fisher Scientific), and primers 16SI Fw (TAATACGACTCACTATAGGGCTTTTCCGGAGTGTAAAAAGCTCC) and 16SI Rv (CCAATAATAGTGGCCACCACTCG); 16SII Fw (TAATACGACTCACTATAG GGGAGTACGGCCGCA) and 16SII Rv (CCCCCGGTGAGGTTCC); 16SIII Fw (TAATACGACTCACTATAGGGAGTACCCGCGCGTCATC) and 16S-3′Rv; 16S-5′Fw and 16SI Rv; 16SI Fw and 16SII Rv; 16SII Fw and 16S-3′Rv, respectively. The relevance of the PCR products was confirmed by sequencing. A linearized pUC18-based plasmid carried a recombinant sR47 gene (Nolivos et al. 2005 (link)). These DNA templates served for RNA production by in vitro transcription using a TranscriptAid T7 High Yield Transcription kit (Thermo Fisher Scientific); RNAs were column- (Zymo Research) or PAGE-purified.

Viral DNA was extracted from dog feces using the QIAamp DNA Mini kit (Qiagen, Valencia, CA, USA). Full-length genome amplification was performed with a Long PCR Enzyme Mix (Thermo Scientific, Waltham, MA, USA), and PCR products were directly sequenced using internal primers according to Pérez et al. (2014) (link).