Puromycin

Manufactured by AppliChem

Sourced in Germany

Puromycin is a laboratory reagent commonly used as a selection marker in cell culture. It is an antibiotic that inhibits protein synthesis, allowing for the selection of cells that have been successfully transfected with a vector containing a puromycin resistance gene.

Automatically generated - may contain errors

Lab products found in correlation

Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (3 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (3 mentions) Facsaria 2, by BD (2 mentions) L glutamine, by Thermo Fisher Scientific (2 mentions) Lipofectamine rnaimax, by Thermo Fisher Scientific (2 mentions) Penicillin, by Merck Group (2 mentions) Streptomycin, by Merck Group (2 mentions) 96 well plate, by BD (1 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions) Gelatin, by Merck Group (1 mentions) Gdc 0980, by Genentech (1 mentions) U0126, by Cell Signaling Technology (1 mentions) Nvp bez235, by Novartis (1 mentions) Protransduzin a, by Immundiagnostik (1 mentions) Minimum essential medium (mem), by Thermo Fisher Scientific (1 mentions) Vero ccl 81 cells, by American Type Culture Collection (1 mentions) Non essential amino acids (neaa), by Thermo Fisher Scientific (1 mentions) Streptomycin, by American Type Culture Collection (1 mentions) Ht1080, by American Type Culture Collection (1 mentions) Hek293t, by American Type Culture Collection (1 mentions)

16 protocols using puromycin

Establishment of Stable Cell Line Expressing YFV Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Baby hamster kidney cells (BHK-21/J cells, kindly provided by Charles M. Rice, NY, USA), were cultured in Minimum Essential Media (MEM, Gibco, Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 7.5% fetal bovine serum (FBS, Gibco), 1% L-glutmine (Gibco), and 1% nonessential amino acids (Gibco), hereinafter named as MEM complete. Vero CCL-81 cells (ATCC, Manassas, VA, USA) and Vero B4 cells (kindly provided by Ute Winke, Bonn, Germany) were cultured in Dulbecco’s Modified Eagle’s medium (DMEM, Gibco) containing 1% L-glutamine and 10% FBS. Cells were maintained at 5% CO₂ and 37 °C.
For the generation of a stable cell line expressing YFV prME and C, BHK-J cells were electroporated with in vitro transcribed RNA derived from the Sindbis virus (SINV) packaging construct SIN-YFprME/C plasmid (see below). To select for SINV replicon containing cells expressing YFV prME and C, the medium was replaced at 24 h post electroporation with MEM complete medium containing puromycin (AppliChem, Darmstadt, Germany) at 5 µg/mL. After selection, the cell population was passaged and maintained in MEM complete medium containing 5 µg/mL puromycin at 5% CO₂ and 37 °C.

Lücke A.C., vom Hemdt A., Wieseler J., Fischer C., Feldmann M., Rothenfusser S., Drexler J.F, & Kümmerer B.M. (2022). High-Throughput Platform for Detection of Neutralizing Antibodies Using Flavivirus Reporter Replicon Particles. Viruses, 14(2), 346.

+ Open protocol

+ Expand

Efficient Cell Line Generation using MIN-Tagging and Bxb1

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

To produce MIN-tagged cell lines, 5 × 10⁵ cells were dissociated and seeded in 0.2% gelatin (Sigma-Aldrich) coated p35 plates. After 3 h, cells were transfected with 2 μg of the MIN-tag donor/homology ssDNA oligo or PCR product, 0.5 μg gRNA construct, 0.5 μg surrogate reporter construct and 1 μg Cas9 using Lipofectamine 3000 (Invitrogen) according to the manufacturer's instructions. For Bxb1-mediated recombination of attB constructs, 5 × 10⁵ cells were transfected with 1 μg pCAG-NLS-HA-Bxb1 expression plasmid ((26 (link)) addgene 51271), 1 μg of the respective attB construct and 0.5 μg Bxb1 surrogate reporter. For both MIN-Tagging and Bxb1-mediated recombination, cells were dissociated, resuspended in ESC medium 48 h post transfection and then analyzed and sorted with a FACS Aria II (Becton Dickinson). For MIN-tagging, enrichment of cells with RGEN activity was accomplished by single-cell sorting GFP and mCherry positive cells into 96-well plates (Falcon) containing 150 μl of ESC medium. For Bxb1-mediated recombination, cells with Bxb1 activity were enriched for by single-cell sorting GFP positive cells into 96-well plates. Alternatively for Bxb1-mediated integration using antibiotic selection, cells were replated into p150 plates with ESC medium containing G418 (0.5 mg/ml, AppliChem) and puromycin (1 μg/ml, AppliChem) 48 h post transfection.

Mulholland C.B., Smets M., Schmidtmann E., Leidescher S., Markaki Y., Hofweber M., Qin W., Manzo M., Kremmer E., Thanisch K., Bauer C., Rombaut P., Herzog F., Leonhardt H, & Bultmann S. (2015). A modular open platform for systematic functional studies under physiological conditions. Nucleic Acids Research, 43(17), e112.

+ Open protocol

+ Expand

Apoptosis Induction in Cell Cultures

Check if the same lab product or an alternative is used in the 5 most similar protocols

Dulbecco's Modified Eagle's Medium/Nutrient Mixture F-12 Ham (DMEM–F12), propidium iodide and Penicillin/Streptomycin 100 × stock solution were purchased from Sigma-Aldrich Chemie GmbH (Buchs, Switzerland). Trypsin solution 0.25% was purchased from GIBCO (Life Technologies Europe, Zug, Switzerland). Fetal calf serum (FCS, CVFSVF00-01) was purchased from Eurobio (Ulis (Les), France). Puromycin was purchased from AppliChem (Darmstadt, Germany). Z-Val-Ala-DL-Asp-fluoromethylketone (Z-VAD-FMK) was purchased from BACHEM (Bubendorf, CH, Switzerland). Nec-1 was purchased Enzo LifeSciences AG (Lausen, Switzerland). NVP-BEZ235 was obtained from Novartis (Basel, Switzerland) and GDC-0980 was obtained from Genentech (Roche, Basel, Switzerland). U0126 was purchased from Cell Signaling Technology (Allschwil, Switzerland). Nivaquine (chloroquine sulfate) was purchased from Sanofi Aventis (Paris, France). Recombinant His₆-GFP-Annexin V was kindly provided by T Kaufmann (Bern, CH, Switzerland).

Echeverry N., Ziltener G., Barbone D., Weder W., Stahel R.A., Broaddus V.C, & Felley-Bosco E. (2015). Inhibition of autophagy sensitizes malignant pleural mesothelioma cells to dual PI3K/mTOR inhibitors. Cell Death & Disease, 6(5), e1757-.

+ Open protocol

+ Expand

Lentiviral Transduction of Jurkat Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

—Jurkat cells were incubated in 500 μl lentivirus and 50 μg/μl Protransduzin-A (Immundiagnostik) for 5 min at RT. The Jurkat cells were transferred to fresh media after 4 h, and were selected with 1 μg/μl puromycin (AppliChem). Transduction efficiency was determined by FACSCanto II. The knockdown was verified by immunoblotting.

Ciprut S., Berberich A., Knoll M., Pusch S., Hoffmann D., Furkel J., Ward Gahlawat A., Kahlert-Konzelamnn L., Sahm F., Warnken U., Winter M., Schnölzer M., Pusch S., von Deimling A., Abdollahi A., Wick W, & Lemke D. (2022). AAMP is a binding partner of costimulatory human B7-H3. Neuro-oncology Advances, 4(1), vdac098.

+ Open protocol

+ Expand

Culturing Corneal Endothelial Cells and Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human corneal endothelial cell population, HCEC-12 [21 (link)], and its derivatives transduced with either empty vector (12EV) or TRPV4 (12V4) were cultured in medium F99HCEC (Ham’s F12/Medium 199, 5% FCS, 20 µg/mL ascorbic acid, 10 ng/mL human recombinant FGF-2, 20 µg/mL human recombinant insulin, 2.5 µg/mL amphotericin B and 50 µg/mL gentamycin) at 37 °C in a humidified atmosphere containing 5% CO₂. Media, supplements and reagents for cell culture were purchased from Life Technologies Invitrogen (Karlsruhe, Germany) or Biochrom AG (Berlin, Germany). Growth medium was changed 3 times per week. Cells were passaged by trypsinization or with Accutase (PAA Laboratories, Pasching, Austria) and routinely seeded at a density of approx. 4000 cells/cm² in T25 culture flasks coated with 10 µg/mL laminin and 10 mg/mL chondroitin sulphate. Cells transduced to overexpress TRPV4 (12V4) were cultured under constant selective conditions with 10 µg/mL puromycin (Applichem, Darmstadt, Germany).
The human embryonic kidney cell lines HEK293T (ATCC CRL-1573) [22 (link)] and HT1080 (ATCC CCL-121) [23 (link)] were cultured in DMEM + 10% FCS and 10 µg/mL penicillin/streptomycin at 37 °C in a humidified atmosphere containing 5% CO2. Cells were passaged by trypsinization at a split ratio of 1:10 or 1:20 at confluence.

Donau J., Luo H., Virta I., Skupin A., Pushina M., Loeffler J., Haertel F.V., Das A., Kurth T., Gerlach M., Lindemann D., Reinach P.S., Mergler S, & Valtink M. (2022). TRPV4 Stimulation Level Regulates Ca2+-Dependent Control of Human Corneal Endothelial Cell Viability and Survival. Membranes, 12(3), 281.

+ Open protocol

+ Expand

Lentivirus-mediated ITK Knockdown in Jurkat Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Small hairpin RNA (shRNA)-mediated ITK knockdown was carried out using a set of lentivirus particles expressing different shRNAs against ITK (MISSION shRNA cat. no. SHGLY-NM_005546; Sigma), or non-target shRNAs (cat. no. SHC002; Sigma). Lentivirus particles were produced by transfecting HEK293T cells with 700 ng shRNA expression plasmid, 280 ng of pMDLg/pRRE^{66 (link)} packaging construct, 110 ng pRSV-Rev^{66 (link)} and 60 ng of VSV-G expression plasmid. Jurkat cells were spin-transduced via centrifugation for 1 h at 31 °C at 2000 rpm by lentivirus particles expressing shRNA. Two days after transduction cells were cultured in the presence of 2 μg/ml puromycin (Applichem, Darmstadt, Germany) for a two-week selection period.

Hain A., Krämer M., Linka R.M., Nakhaei-Rad S., Ahmadian M.R., Häussinger D., Borkhardt A, & Münk C. (2018). IL-2 Inducible Kinase ITK is Critical for HIV-1 Infection of Jurkat T-cells. Scientific Reports, 8, 3217.

+ Open protocol

+ Expand

CRISPR-Mediated LFA-1 Knockout in Jurkat Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

For LFA-1 knock-out, Cas9 and sgRNA (TGCCCGACTGGCACTGATAGAGG) targeting ITGAL (pLenti-ITGAL) were delivered into Jurkat cells by lentiCRISPRv2-based lentiviral transduction^{38 (link)}. Lentiviral particles were produced by transfecting HEK293T cells with 800 ng pLenti-ITGAL, 800 ng packaging construct psPAX2 (Trono laboratory, obtained from Addgene, Cambridge, USA) and 300 ng VSV-G expression plasmid. Jurkat cells were spin-transduced via centrifugation for 90 min at 1200 rpm at room temperature. Three days after transduction medium was replaced with medium containing 2 μg/ml puromycin (Applichem, Darmstadt, Germany).

+ Open protocol

+ Expand

Lentiviral Transduction and Stable Cell Line Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Transient transfections of siRNAs were performed using Lipofectamine RNAiMAX (Thermo Fisher Scientific) according to the manufacturer’s instructions. Lentiviral particles for the generation of stably transfected cell lines expressing either shRNAs or cDNAs were generated by cotransfection of HEK293T cells with the lentiviral vector and the packaging vectors psPAX2 and pMD2.G (kindly provided by Dr. Didier Trono, Addgene plasmids #12260 and #12259) in a ratio of 3:2:1 into HEK293T cells. Lentiviral particles-containing HEK293T supernatants were harvested one day after transfection. MCF7 and MDCKII target cells were incubated with lentiviral supernatants for 24 h. Transduced cells were maintained in standard culture medium supplemented with 1 μg/mL puromycin (AppliChem). MCF7 cells and MDCKII cells expressing JAM-A shRNAs under a doxycycline-regulated promoter were generated by electroporation of cells with plasmid pEmU6-proT (provided by Dr. Karl Matter). Transfectants were selected with 500 ug/ml G418 (AppliChem) and 7 ug/ml blasticidin (InvivoGen).

Schwietzer M.F., Thölmann S., Kummer D., Kaschler A., Greune L., Thüring E.M., Schmidt M.A., Gerke V, & Ebnet K. (2022). Loss of contact inhibition of locomotion in the absence of JAM-A promotes entotic cell engulfment. iScience, 25(10), 105144.

+ Open protocol

+ Expand

Cultivation of Leishmania donovani Promastigotes

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Leishmania donovani strain 1S [29 (link)] promastigotes and derived mutants were cultured at 25 °C in M199+ medium [30 (link)] with the respective antibiotics: puromycin (25 µg/mL, AppliChem, Darmstadt, Germany), blasticidin (5 µg/mL), G418 (50 µg/mL) and hygromycin B (50 µg/mL, all Carl Roth, Karlsruhe, Germany). Cells were passaged every 3–4 days.

Bea A., Kröber-Boncardo C., Sandhu M., Brinker C, & Clos J. (2020). The Leishmania donovani SENP Protease Is Required for SUMO Processing but Not for Viability. Genes, 11(10), 1198.

+ Open protocol

+ Expand

Overexpression of CHI3L1 in PDGCLs

Check if the same lab product or an alternative is used in the 5 most similar protocols

S24wt, T269wt and P3XXwt were transduced with the Ctrl or CHI3L1 overexpression plasmids as described in Section Cell Culture of PDGCLs, and 24 h after transduction virus containing medium was replaced by 1 µg/ml Puromycin (#A2856.0100, Applichem, Darmstadt, Germany) containing selection media. FACS was additionally used to select positive clones.

Hai L., Hoffmann D.C., Wagener R.J., Azorin D.D., Hausmann D., Xie R., Huppertz M.C., Hiblot J., Sievers P., Heuer S., Ito J., Cebulla G., Kourtesakis A., Kaulen L.D., Ratliff M., Mandelbaum H., Jung E., Jabali A., Horschitz S., Ernst K.J., Reibold D., Warnken U., Venkataramani V., Will R., Suvà M.L., Herold-Mende C., Sahm F., Winkler F., Schlesner M., Wick W, & Kessler T. (2024). A clinically applicable connectivity signature for glioblastoma includes the tumor network driver CHI3L1. Nature Communications, 15, 968.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!