Whole-cell lysis was performed as previously described [15 (link), 27 (link)]. The membranes were probed with anti-PTEN (1:1000, Cell Signaling, Danvers, USA) and anti-β-actin antibodies (1:2500, Santa Cruz Biotechnologies, Dallas, USA). Signals were visualized using the SuperSignal West Dura chemiluminescence kit (Thermo Fisher Scientific, Waltham, USA) and imaged on a Chemidoc gel imager (Bio-Rad, Hercules, USA). Images were quantified using the Image J software (NIH).
Chemidoc gel imager
Manufactured by Bio-Rad
Sourced in United States
The ChemiDoc gel imager is a compact, high-performance imaging system designed for capturing and analyzing DNA, RNA, and protein gels. It utilizes a CCD camera and a range of illumination sources to capture high-quality images of stained gels. The system is capable of detecting a variety of common fluorescent and chemiluminescent dyes and labels.
Automatically generated - may contain errors
Lab products found in correlation
Thermal gradient device, by Eppendorf (3 mentions)
Supersignal west dura chemiluminescence kit, by Thermo Fisher Scientific (2 mentions)
Thermal gradient apparatus, by Eppendorf (2 mentions)
Rabbit anti erk1 2, by Cell Signaling Technology (2 mentions)
Rabbit anti p erk1 2, by Cell Signaling Technology (2 mentions)
Mini protean tgc gel, by Bio-Rad (2 mentions)
Mini protean tgx stain free, by Bio-Rad (2 mentions)
Anti β tubulin, by Santa Cruz Biotechnology (2 mentions)
Rabbit anti lef1, by Cell Signaling Technology (2 mentions)
Amersham ecl western blotting, by Cytiva (2 mentions)
Anti β actin antibody, by Santa Cruz Biotechnology (1 mentions)
Anti pten, by Cell Signaling Technology (1 mentions)
Bolt 4 12 bis tris plus gel, by Thermo Fisher Scientific (1 mentions)
Supersignal west pico plus chemiluminescent substrate, by Thermo Fisher Scientific (1 mentions)
Anti grb2, by Cell Signaling Technology (1 mentions)
Anti mouse igg2b, by Southern Biotech (1 mentions)
Anti sos1, by Cell Signaling Technology (1 mentions)
Anti flag l5, by BioLegend (1 mentions)
Prism v8, by GraphPad (1 mentions)
Hybond n, by Bio-Rad (1 mentions)
24 protocols using chemidoc gel imager
1
Western Blot Analysis of PTEN
2
Genetic Analysis of Sheep FST Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genetic analysis was performed by collecting blood from the sheep’s jugular vein.
Rapid salting-out method was used for the extraction of genomic DNA.17 (link)
NCBI Primer-BLAST18 (link)
was used to amplify the FST genetic sequence for all 232
animals. Polymerase chain reaction (PCR) experiments were performed with Bioneer
PreMix (50 μM deoxynucleotide triphosphates [dNTPs], 10, 30, and 1.5 mM
Tris-HCl, KCl, and MgCl2, respectively, and 1 U Top DNA polymerase).
The optimal PCR amplification conditions were determined using a thermal
gradient device (Eppendorf, Germany) (Table 1 ). The PCR reaction was
performed at 94°C for 4 minutes, then 30 cycles (30 seconds each) of 94°C,
annealing, and 72°C were conducted.19 (link)
A Chemidoc Gel Imager (Bio-Rad, USA) was used to image agarose gel images
of PCR products electrophoresed on agarose gels (2%).20 (link)
Rapid salting-out method was used for the extraction of genomic DNA.17 (link)
NCBI Primer-BLAST18 (link)
was used to amplify the FST genetic sequence for all 232
animals. Polymerase chain reaction (PCR) experiments were performed with Bioneer
PreMix (50 μM deoxynucleotide triphosphates [dNTPs], 10, 30, and 1.5 mM
Tris-HCl, KCl, and MgCl2, respectively, and 1 U Top DNA polymerase).
The optimal PCR amplification conditions were determined using a thermal
gradient device (Eppendorf, Germany) (
performed at 94°C for 4 minutes, then 30 cycles (30 seconds each) of 94°C,
annealing, and 72°C were conducted.19 (link)
A Chemidoc Gel Imager (Bio-Rad, USA) was used to image agarose gel images
of PCR products electrophoresed on agarose gels (2%).20 (link)
3
Quantifying CRISPR Inhibition Dynamics
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The buffer used in DNA cleavage reactions was NEB buffer 3.1 (100 mM NaCl, 50 mM Tris-HCl, pH 7.9, 10 mM MgCl2, 100 µg/mL BSA); proteins were diluted in 130 mM NaCl, 25 mM Tris, pH 7.4, 2.7 mM KCl. SpyCas9 (0.4 µM) and AcrIIA11 (0.4–12.8 µM) were incubated for 10 min at room temperature before the reaction was started by simultaneously adding 0.4 µM sgRNA and 4 nM linearized plasmid (2.6 Kb) and transferring reactions to a 37°C water bath. After 10 min at 37°C, the reaction was stopped by adding 0.1% SDS and 50 mM EDTA. Reactions were then run on a 1.25% agarose gel containing ethidium bromide at 115V for 2 hr at room temperature. Gels were imaged using the ethidium bromide detection protocol on a BioRad Chemidoc gel imager.
4
Immunoblotting of Bacterial Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Saturated overnight cultures were diluted 1:100 into 5 mL fresh LB broth supplemented with 0.2% arabinose and appropriate antibiotics. Cells grew at 37 °C until they reached the mid-logarithmic phase. Cultures were standardized by absorbance measurements at 600 nm and aliquots were collected and resuspended in an SDS-PAGE buffer. SDS-PAGE was used to resolve proteins which were then transferred to nitrocellulose membranes. Immunoblotting was performed overnight with monoclonal anti-FLAG (1:5,000), anti-Strep (1:1,000), anti-His (1:1,000), and polyclonal anti-MBP (1:15,000), anti-LamB (1:15,000), and anti-CpxR (1:30,000) antibodies, where appropriate. Blots were subsequently incubated with either anti-mouse or anti-rabbit antibodies conjugated to HRP for 1 h. Blots were developed by chemiluminescence and imaged on a BioRad ChemiDoc gel imager.
5
Western Blot Analysis of Immune Signaling Proteins
6
DNA Binding Assay Protocol
7
Detecting BCL-X mRNA Isoforms via RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To detect the long and short isoforms of BCL-X mRNA, RT-PCR was used. RNA was extracted using TRIzol reagent (Life Tech) according to the manufacturer’s instructions. RNA was then converted to cDNA using the RevertAid Reverse Transcriptase Kit (Thermo Fisher Scientific) with oligo-dT primers. Next, PCR was performed with the following primers: GAPDH (for: TGCACCACCAACTGCTTAGC ; rev: TCAGCTCAGGGATGACCTTG ), BCL-X set 1 (for: AGTAAAGCAAGCGCTGAGGGAG ; rev: ACTGAAGAGTGAGCCCAGCAGA ) [60 (link)], BCL-X set 2 (for: GAGGCAGGCGACGAGTTTGAA; rev: TGGGAGGGTAGAGTGGATGGT ) [61 (link)]. The PCR cycled as follows: 95°C for 2min to start, followed by 95°C for 30sec, 45°C for 1min, and 68°C for 1min (cycled 30 times), with a final 5-minute incubation at 68°C. The PCR product was then run on a 2% agarose gel and imaged with a ChemiDoc Gel Imager (Bio-Rad).
8
Ovine PTX3 Gene Amplification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from 5 ml of sheep blood collected from the jugular vein using rapid salting-out methods.27 (link)
The Primer 3 online program28 (link)
was employed to design PCR primers based on the sequence of the ovine PTX3 (Oar_v4.0; Chr 1, NC_056054.1). To identify the optimal conditions for PCR amplification, we used a Bioneer premix and the Eppendorf thermal gradient apparatus from Germany. The PCR was performed, and thermal gradients were applied to determine the optimal amplification conditions, as detailed inTable 1 . The amplification conditions were as follows: 5 minutes of initial denaturation at 94 °C; 30 seconds of denaturation at 94 °C; 45 seconds of annealing; 30 seconds of extension at 72 °C, for a total of 30 cycles; and 5 minutes of final extension at 72 °C followed by storage at 4 °C.29 (link)
Electrophoresis of PCR products on 2% agarose gels was performed and images were captured using a Chemidoc Gel Imager (Bio-Rad, Hercules, California).30 (link)
The Primer 3 online program28 (link)
was employed to design PCR primers based on the sequence of the ovine PTX3 (Oar_v4.0; Chr 1, NC_056054.1). To identify the optimal conditions for PCR amplification, we used a Bioneer premix and the Eppendorf thermal gradient apparatus from Germany. The PCR was performed, and thermal gradients were applied to determine the optimal amplification conditions, as detailed in
Electrophoresis of PCR products on 2% agarose gels was performed and images were captured using a Chemidoc Gel Imager (Bio-Rad, Hercules, California).30 (link)
9
Quantification of NDP52 Protein Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell pellets from HeLa and MCF-7 cells, following NDP52 KD or control siRNA, were heat-denatured and resolved by SDS-PAGE. Membranes were probed against actin (Abcam, ab6276) and NDP52 by incubation with rabbit polyclonal primary antibody (1:2000 dilution, GeneTex, GTX115378) and, subsequently, a goat anti-rabbit antibody, coupled to horseradish peroxidase (1:15,000 dilution, Abcam, ab6721). Bands were visualised with ECL Western Blotting detection reagents (Invitrogen) using a ChemiDoc gel imager (Bio-Rad). For Ponceau S staining, membranes were incubated for 5 min in Ponceau S reagent (Sigma), washed three times with water and then imaged.
10
Gel Shift Assay for DNA Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The gel electro-mobility
shift assay was performed on a 2% native agarose gel with 1×
TBE buffer using 1× TBE buffer as a running buffer. A sucrose
loading buffer was prepared by dissolving 4 g in 10 mL MilliQ water.
Five μL of this buffer was then added to 25 μL of each
sample. Twenty-five μL aliquots of the resulting solutions containing
Triton-X (0.04%), Cy3-bischol-TBA29 (125 nM), Cy5-bischol-TBA15 (200
nM), and complementary DNA (100 nM) or scrambled DNA (100 nM) was
then loaded into wells, and the gel was run at 130 V for 1 h. After
electrophoresis, the gel was stained with GelRed nucleic acid gel
stain (Biotium) and visualized under UV transillumination with a ChemiDoc
gel imager from Bio-Rad.
shift assay was performed on a 2% native agarose gel with 1×
TBE buffer using 1× TBE buffer as a running buffer. A sucrose
loading buffer was prepared by dissolving 4 g in 10 mL MilliQ water.
Five μL of this buffer was then added to 25 μL of each
sample. Twenty-five μL aliquots of the resulting solutions containing
Triton-X (0.04%), Cy3-bischol-TBA29 (125 nM), Cy5-bischol-TBA15 (200
nM), and complementary DNA (100 nM) or scrambled DNA (100 nM) was
then loaded into wells, and the gel was run at 130 V for 1 h. After
electrophoresis, the gel was stained with GelRed nucleic acid gel
stain (Biotium) and visualized under UV transillumination with a ChemiDoc
gel imager from Bio-Rad.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!