Previously published plasmids and their references containing promoter constructs are listed in Table 1 . Primers used in this study are listed in Table 2 . We amplified 1.2 kb upstream of the rab-3 start codon from genomic DNA using primers fprab-3 and prab-3r. We used Invitrogen BP clonase to recombine the PCR product with pDG15 (Reiner et al. 2006 (link)) to generate plasmid pBL363. We amplified 2 kb upstream of the aex-2 start codon using primers fPaex-2 and Paex-2r. We used Invitrogen BP clonase to recombine the PCR product with pDONR to generate plasmid pBL348. To create Punc-103 J, we removed part of the Punc-103E promoter from pXG31[Punc-103 E:YFP:actin] (Guo et al. 2012 ) using primers fpXG31 and pXG31r. Punc-103 J starts with sequence 5′-GTAAGTGGAACTTTT-3′ and ends with sequence 5′-TCATCGACTGGAGCA-3′. We ligated the PCR product to create pLR343. We recombined pLR343 with pDONR using BP clonase to create plasmid pBL373.
Bp clonase
Manufactured by Thermo Fisher Scientific
Sourced in United States
BP clonase is a recombinant enzyme used for DNA cloning and gene expression. It catalyzes the site-specific recombination between attB and attP sites, allowing the efficient transfer of DNA sequences between vectors.
Automatically generated - may contain errors
Lab products found in correlation
Lr clonase, by Thermo Fisher Scientific (57 mentions)
Gateway system, by Thermo Fisher Scientific (6 mentions)
Pdonr221 vector, by Thermo Fisher Scientific (5 mentions)
Gateway lr clonase, by Thermo Fisher Scientific (5 mentions)
Lr clonase 2, by Thermo Fisher Scientific (5 mentions)
Lr reaction, by Thermo Fisher Scientific (4 mentions)
Pdonr zeo, by Thermo Fisher Scientific (4 mentions)
Pdonr221, by Thermo Fisher Scientific (4 mentions)
Phusion polymerase, by New England Biolabs (3 mentions)
Superscript 3, by Thermo Fisher Scientific (3 mentions)
Pdonr, by Thermo Fisher Scientific (3 mentions)
Genejet gel extraction kit, by Thermo Fisher Scientific (2 mentions)
Phusion flash high fidelity pcr master mix, by Thermo Fisher Scientific (2 mentions)
Pdonr207, by Thermo Fisher Scientific (2 mentions)
Gateway technology, by Thermo Fisher Scientific (2 mentions)
Phusion dna polymerase, by Thermo Fisher Scientific (2 mentions)
Pdonr201 vector, by Thermo Fisher Scientific (2 mentions)
Plenti cmv blast dest vector, by Thermo Fisher Scientific (2 mentions)
Superscript 4 cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Veriti thermocycler, by Thermo Fisher Scientific (2 mentions)
133 protocols using bp clonase
1
Generating Promoter Constructs for C. elegans
2
Constructing Entry and Expression Clones
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The procedure for the construction of entry and expression clones using the Gateway® system has been well described previously 14 (link), 20 (link), 23 (link), 40 (link). Briefly, all purified PCR products and synthesized ORF sequences with attB1 and attB2 sites were cloned into a Gateway® entry vector (pDONR221) using BP Clonase (Life Technologies, Grand Island, NY). The clones were colony selected from agar plates and the ORF inserts were sequenced verified using our Automatic Clone Evaluation (ACE) software. For clones to be accepted in our viral gene plasmid collection, they must not contain truncations, frameshifts, or more than one amino acid change when compared to the reference sequence. In addition, any nucleotide change in the sequences of att-sites was also not accepted because it may cause failure of BP or LR reactions 20 (link), 21 (link).
To construct the collection of expression clones, sequence verified viral ORFs in entry vectors were transferred into mammalian cell-free expression vectors (pANT7_cGST, pJFT7_nHalo or pJFT7_cHalo) using LR Clonase (Life Technologies, Grand Island, NY). All solution transfers were executed by the Biomek FX automation workstation, and each cloning step was assigned a specific barcode which is tracked by the FLEXGene database throughout the cloning process.
To construct the collection of expression clones, sequence verified viral ORFs in entry vectors were transferred into mammalian cell-free expression vectors (pANT7_cGST, pJFT7_nHalo or pJFT7_cHalo) using LR Clonase (Life Technologies, Grand Island, NY). All solution transfers were executed by the Biomek FX automation workstation, and each cloning step was assigned a specific barcode which is tracked by the FLEXGene database throughout the cloning process.
3
Genome Sequencing of L. dumoffii Strain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An Ontario Legionella dumoffii strain (L. dumoffii str Hamilton, a kind gift from C. Guyard and Public Health Ontario) was subjected to Illumina MiSeq 250x250x8 (paired‐end) sequencing at the Donnelly Sequencing Centre, University of Toronto, as described previously (Rao et al, 2013 ). The resulting raw paired‐end sequence reads were deposited as Illumina FASTQ files to the NCBI sequence read archive (study accession: SRP051121). Contigs were assembled from these reads using the Velvet de novo assembler (Zerbino & Birney, 2008 ) and subjected to automatic annotation using Prokka (Seemann, 2014 ) with default settings. Orthologs for the L. pneumophila genes lpg2975, lpg0130, lpg0695, and lpg0696 were identified with PGAP (Zhao et al, 2012 ) using the MultiParanoid method with default settings. The L. dumoffii orthologs (Table EV9 ) were amplified by PCR from L. dumoffii str Hamilton genomic DNA and cloned by Gateway BP reactions with BP clonase (Life Technologies) to pDONR221‐ccdB (Life Technologies). The resulting pDONR‐IDTS plasmids were sequence‐verified and the yeast toxic IDTS orthologs, LdumoAE_01458 (mavQ) and LdumoAE_01458 (ankX), were cloned into pAG426GAL‐ccdB and pDEST‐AD, while the cognate IDTS orthologs, LdumoAE_01218 (sidP) and LdumoAE_01010 (lem3), were cloned into pAG423GAL‐HA‐ccdB and pDEST‐DB. Spot dilution assays and Y2H assays were performed as described above.
4
Cloning and Expression of PATL2 Fusion Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cDNA for PATL2 was cloned by RT–PCR with primers 5′-ACAAGTTTGTACAAAAAAGCAGGCTTCATGGCTCAAGAAGAGATACAG-3′ and 5′-ACCACTTTGTACAAGAAAGCTGGGTATGCTTGGGTTTTGGACCT-3′. The amplified DNA fragment was cloned into pDONR201 with BP clonase® (Life Technologies, http://www.lifetechnologies.com/ ). From this entry clone, the recombinant cDNA was transferred to various destination vectors by LR® clonase (Life Technologies). For expression of GST-fused and MBP-fused PATL2 in E. coli, pDEST17 and pDESTMAL, derived from pMAL-c5X, were used as destination vectors, respectively. Two types of fluorescent proteins were fused to PATL2: G3GFP, which has two amino acid substitutions (Ser65 and Tyr145) with alanine and phenylalanine, respectively (Kawakami and Watanabe 1997 ), and mRFP. For expression of these fusion genes, a series of pGWB plasmids was used as destination vectors (Nakagawa et al. 2007 (link)). The binary vectors were introduced into plants by Agrobacterium-mediated transformation.
5
Cloning of Gene Candidates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All the gene candidates were synthesized by Invitrogen, Life Technologies. PCR amplification of each gene candidate was performed using the synthesized sequence as the template with a pair of specific primers (Additional file 1 : Table S3) with attB1 and attB2 sites incorporated on a Veriti Thermo Cycler using Phusion Flash High-Fidelity PCR Master Mix (Thermo Scientific ™). Cycling parameters were as follows: an initial denaturing step at 98 °C for 30 s, 38 cycles at 98 °C for 5 s, 55 °C for 10 s, 72 °C for 50 s, followed by a final extension step at 72 °C for 10 min. The PCR products were subjected to agarose gel electrophoresis and purified using the GeneJET Gel Extraction Kit (Thermo Scientific™). Then the ORFs were cloned into the pDONR221 vector in presence of BP clonase (Life Technologies) to generate the entry clone. After the entry clone for each ORF was confirmed by sequencing with M13+ and M13- primers, it was cloned into either the yeast expression vectors pYEX-CHT or pYES52 or the plant expression vector pXZP393 by LR reaction (Invitrogen). The resulting expression clones were analyzed by sequencing.
6
Generating GFP-tagged NOTCH1 constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human N1ICD and N1ICDdC were amplified by PCR from pcDNA3-NOTCH1 expressing vector (kindly provided by Stephen C. Blacklow, Boston). The N1ICD sequence encodes for amino acids 1754–2555 whereas N1ICDdC encodes for amino acids 1754–2301 of human NOTCH1. The oligonucleotides included the BP recombination sites attB. To generate the entry clones pDONR 221-N1ICD and pDONR 221-N1ICDdC, BP Clonase® (Life Technologies) was used for BP recombination reaction between the attB-containing PCR products and the attP-containing donor vector pDONR 221. To generate N-terminally GFP-tagged N1ICD and N1ICDdC expressing plasmids, LR ClonaseTM was used for LR recombination reaction between attL-containing pDONR 221-N1ICD or pDONR 221-N1ICDdC and attR-containing destination vector pDEST53 or pgLAP141 (link).
7
Cloning and Characterization of Soybean MAX Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Homologues of Arabidopsis MAX genes and rice DWARF genes were identified through homology search against soybean genome on public database (Phytozome.org ). For gene cloning, total RNA was extracted from 14-days old Glycine max leaves, stems, or roots of soybean (Glycine max) variety “Tianlong #1”. About 10 μg of total RNA was used to synthesize first-strand cDNA using the first-strand synthesis system (Invitrogen). The cDNA were used as a template for amplification of the open reading frames (ORFs) of GmMAX genes with pairs of gene-specific primers (Additional file 1 : Table S1). After all GmMAX ORFs were cloned into T-easy vector and sequenced for verification, the ORFs for GmMAX1a (Glyma04g05510.3) GmMAX1b (Glyma06g05520.2), GmMAX2a (Glyma.12 g15360.1), GmMAX3b (Glyma11g16370.1), GmMAX4a (Glyma04g08910.1), GmMAX4b (Glyma06g09000.2), were amplified by using long primers for being subcloned into pDONR221 by using recombination enzyme BP clonase (Life Technologies). The resulted pDONR221 clones harboring various GmMAX ORFs were verified by sequencing and then recombined into different Gateway destination vectors, including pB2GW7 for overexpression and pB7GWIWGII for knockdown using LR clonase (Life technologies, CA, USA).
8
Yeast Expression Vectors Construction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the construction of yeast expression vectors containing the candidate genes, specific primers with attB1 and attB2 sites incorporated were designed for amplifying the ORF of genes of interest. The PCR products were subjected to agarose gel electrophoresis and purified using the Wizard® SV Gel and PCR Clean up system (Promega Biotech AB, Nacka, Sweden). The ORFs were subcloned into the pDONR221 vector in presence of BP clonase (Life Technologies), after confirmation by sequencing, the correct entry clones were selected and do LR reaction with pYES2-DEST52 (for FARs and acetyltransferases) or pYEX-CHT-DEST vector (for desaturases), and resulting expression clones were analyzed by sequencing.
9
Generation of Inducible Ets-1 Lentiviral Vector
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The inducible Ets-1 lentiviral vector was created using gateway cloning as described earlier [48 (link)]. Briefly, human Ets-1 cDNA was amplified from pDONR223_ETS1_WT (Addgene # 82118) using primers attB1-hEts-1: GGGGACAAGTTTGTACAAAAAAGCAGGCTACCATGAAGGCGGCCGTCGATCTCAAGCCGACTCTCAC and attB2-Myc-hEts-1 GGGGACCACTTTGTACAAGAAAGCTGGGTCTATTACAGATCCTCTTCTGAGATGAGTTTTTGTTCCTCGTCGGCATCTGGCTTGACGTCCAGCATGGCGTGCAGCTCC and cloned into pDONR221 vector (Life Technologies, USA, # 12536017) using BP Clonase (Life technologies, USA # 11789100), to make the entry clone. The LR recombination reaction was performed with the entry clone using LR Clonase (Life technologies, USA, # 11791020) to generate the doxycycline-inducible Ets-1 lentiviral vector in pLIX_403 backbone (Addgene # 41395).
10
Generating Tagged ATF6α Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The coding region for 3xFLAG-HsATF6α was obtained from pCMV7-3xFLAG-HsATF6a (kind gift from Ron Prywes) (Shen and Prywes, 2004 (link)). The R416A mutation was introduced by site-directed mutagenesis using a single oligonucleotide 5’ - gtgagccctgcaaatcaaaggGCgcaccttctaggattttctgc – 3’. Wild-type or R416A alleles were amplified by PCR using a 5’ oligonucleotide containing 6xHIS and attB1 site and 3’ oligo with attB1 site and recombined using Gateway technology firstly into the entry vector pDONR-221 using BP clonase (Life Technologies # 11789020) and from there into the destination vector pDEST-FRT-TO using LR clonase (Life Technologies # 11791020).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!