SpCas9 target sequence (5′-GGTGTGTCTTCTGTTCGGTC-3′) located in the first third of the unique MAFB coding exon was designed using a CRISPOR algorithm [29 (link)]. Alt-R®-crRNA corresponding to the MAFB target sequence and a human crRNA negative control were purchased from Integrated DNA Technologies IDT (Coralville, IA, USA). Alt-R® Hifi S.p. Cas9 Nuclease V3 (10 nM corresponding to 240 ng, IDT) was mixed with an equal molarity of each two-part gRNA (Alt-R®-crRNA + Alt-R®-tracrRNA) reconstituted following the supplier’s recommendations (IDT). Reverse transfection was performed on 40,000 Hep3B cells using Lipofectamine CRISPRMAX™ Reagent (Thermo Fisher Scientific, Bordeaux, France). At 2–3 days post transfection, a sample of cells was lysed and used as PCR template using Phire Tissue Direct PCR Master Mix (ThermoFisher Scientific). PCR amplification with subsequent Sanger sequencing of the targeted MAFB sequence was performed according the supplier’s recommendations with external specific primers (5′-CTCAGCACTCCGTGTAGCTC-3′ and 5′-ACGCTTGGTGATGATGGTGA-3′). Sanger data were used to quantify Indels reflecting gene knock-out (KO) with the TIDE and ICE (Inference of CRISPR Edits) algorithms [30 (link),31 ].
Lipofectamine crisprmax reagent
Manufactured by Thermo Fisher Scientific
Sourced in France
Lipofectamine CRISPRMAX reagent is a transfection reagent designed for efficient delivery of CRISPR-Cas9 components into a variety of cell types. It facilitates the introduction of guide RNA and Cas9 protein or DNA into cells to enable genome editing applications.
Automatically generated - may contain errors
Lab products found in correlation
Truecut cas9 protein v2, by Thermo Fisher Scientific (3 mentions)
Cas9 plus reagent, by Thermo Fisher Scientific (3 mentions)
Opti mem, by Thermo Fisher Scientific (3 mentions)
Trueguide synthetic grna platform, by Thermo Fisher Scientific (2 mentions)
Phire tissue direct pcr master mix, by Thermo Fisher Scientific (1 mentions)
Alt r crrna, by Integrated DNA Technologies (1 mentions)
Zero blunt topo pcr cloning kit, by Thermo Fisher Scientific (1 mentions)
Geneart precision grna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Xl1 blue, by Agilent Technologies (1 mentions)
Trueguide synthetic grna, by Thermo Fisher Scientific (1 mentions)
Guide it mutation detection kit, by Takara Bio (1 mentions)
Hek293t cell line, by American Type Culture Collection (1 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Merck Group (1 mentions)
14 protocols using lipofectamine crisprmax reagent
1
MAFB Gene Editing using SpCas9
2
CRISPR-mediated Tmem161a Knockout in MC3T3-e1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Single guide (sg)RNAs were constructed using a GeneArt precision gRNA synthesis kit (ThermoFisher Scientific) with forward primer 5ʹ-TAATACGACTCACTATAGCAGCGTGCGAAGGAAC-3ʹ and reverse primer: 5ʹ-TTCTAGCTCTAAAACCACTGTTCCTTCGCACGCT-3ʹ. The PAM sequence was located within Tmem161a exon2 and designed as CAGCGTGCGAAGGAACAGTG.
MC3T3-e1 cells were transfected with the generated sgRNA, Lipofectamine CRISPR max reagent (ThermoFisher Scientific), and True cut cas9 protein V2 (ThermoFisher Scientific). The KO cell line was then established using the limited dilution method in a 96-well plate. Mutant sequences were confirmed by direct sequencing. The KO cells were cloned using a Zero Blunt TOPO PCR cloning kit (ThermoFisher Scientific) and XL-1 blue (Agilent Technologies, Santa Clara, CA, USA), followed by sequencing analysis.
MC3T3-e1 cells were transfected with the generated sgRNA, Lipofectamine CRISPR max reagent (ThermoFisher Scientific), and True cut cas9 protein V2 (ThermoFisher Scientific). The KO cell line was then established using the limited dilution method in a 96-well plate. Mutant sequences were confirmed by direct sequencing. The KO cells were cloned using a Zero Blunt TOPO PCR cloning kit (ThermoFisher Scientific) and XL-1 blue (Agilent Technologies, Santa Clara, CA, USA), followed by sequencing analysis.
3
CRISPR-Cas9 Knockout of AGTR-1 in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For knockout of AGTR-1, the genomic edition will be mediated by TrueGuide™ Synthetic gRNA (catalogue A35513, Thermo Fisher Scientific) AGTR1 Human (ID: GRFVK2T) and AGTR1 Canine (ID: GRDJXWX) using Lipofectamine™ CRISPRMAX™ reagent (Thermo Fisher Scientific) for transfection. The CRISPR/Cas9 was performed according to the manufacturer’s instructions (Invitrogen™ TrueGuide™ Synthetic gRNA).
The cells were plated (Table 1 ) and after 24 h the transfection was performed by Lipofectamine™, which is a lipid nanoparticle transfection reagent for CRISPR-Cas9 protein delivery. For the preparation of the transfection complex (Table 1 ), first Tube 1 was prepared containing: Cas9 protein + sgRNA Solution with Cas9 Plus™ Reagent in Opti-MEM™ I Medium. Then, Tube 2 was prepared by diluting Lipofectamine™ CRISPRMAX™ reagent in Opti-MEM™ I Medium. Tube 2 was incubated for 1 min at room temperature. After, the Tube 2 was added to the Tube 1 and it was mixed by pipetting. This mixture was incubated for 10 min at room temperature, followed by the addition of this transfection complex (10 μL in each well of 96 wells plate, 50 μL in 24 wells and 250 μL in 6 wells) to the previously plated cells and then incubated at 37 °C. After 2 days of incubation, the culture medium was removed and the adherent cells were washed with PBS to proceed with the other applications.
The cells were plated (
4
Generating Knockout Cell Lines Using CRISPR-Cas9
5
CRISPR Knockout of SULF1 in HS27A Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Gene Knockout Kit for was purchased from Synthego (CA, USA), which included single guide RNAs (sgRNAs) for SULF1, Cas9 enzyme (Streptococcus pyogenes) and a validated sgRNA for RELA to serve as a positive control. The kit was used to deliver the sgRNA-Cas9 ribonucleoproteins (RNPs) to HS27A cells with Lipofectamine CRISPRMAX reagent (ThermoFisher; L3000001), according to the protocol provided by Synthego. Reverse transfection was the method of choice for delivery of Lipofectamine-RNP complexes, which were added to wells of 12-well plates, followed by the addition of HS27A in suspension, at 80-100,000 cells/well or 20-25,000 cells/cm2. mRNA was isolated 48h post-transfection, and qPCR was performed for gene expression analysis. Also at the 48h time-point, other replicate groups were used for isolation and expansion of multiple monoclonal populations via limiting dilution, until we obtained the SULF1 knockout HS27A line. Potential clones were screened through qPCR, in addition to the tool Inference of CRISPR Edits (ICE) developed by Synthego (https://ice.synthego.com ) (S12 Fig ).
6
Kras G12D to G12C Conversion
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To convert LKR13K, LKR13KK and LKR13KL cell lines from Kras G12D to Kras G12C by homologous-directed repair, 50,000 cells were plated in a six-well plate and endogenous Kras G12D was knocked out using the snRNP complex by co-transfecting 13.8 µg of Cas9 nuclease (IDT) with 2.8 µg of G12D sgRNA (5′-GTGGTTGGAGCTGATGGCGT-3′) and 1 µM of G12C ssODN (5′-AGTTGTATTTTATTATTTTTATTGTAAGGCCTGCTGAAAATGACTGAGTATAAGCTTGTGGTGGTTGGAGCTTGTGGTGTAGGCAAGAGCGCCTTGACGATACAG 3′) using Lipofectamine CRISPRMax reagent (Thermo). Forty-eight hours after transfection, cells were cultured in the presence of 1 µM MRTX1133 (Kras G12D inhibitor) to select for positively converted cells.
7
Cas13a-mediated inhibition of influenza virus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
During virus adsorption, crRNA/Cas13a complexes were prepared according to optimized conditions: 500 ng Cas13a protein, 125 ng crRNA, 1 μL Reagent PLUS, and 25 μL Opti-MEM in tube 1, and 1.5 μL Lipofectamine CRISPR MAX reagent (Thermo) and 25 μL Opti-MEM in tube 2. The components were mixed thoroughly and incubated for 5 min at room temperature, after which those of both tubes were mixed and incubated at RT for 25 min. The complexes containing crRNA-Cas13a, Cas13a alone, or the transfection reagent alone were added to PR8-infected cells and incubated for 4 h. Finally, 0.5 mL of DMEM containing 1% bovine serum albumin (BSA), 1% penicillin and streptomycin, glutamine, and 1 mg/mL L-1-tosylamido-2-phenylethyl chloromethyl ketone (TPCK) were added to each well and incubated at 37°C and 5% CO2 for 24 h. Cells were harvested to extract RNA and viral RNA was detected by reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Infectious viral particles were verified by median tissue culture infectious dose (TCID50), and plaque assays.
8
Generating Knockout Cell Lines Using CRISPR-Cas9
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate knockout lines of Cal27, Detroit 562, and FaDu cell lines, Ribonucleoprotein (RNP)-mediated CRISPR-Cas9 genome editing was performed using the Alt-R CRISPR-Cas9 System (IDT) and designing synthetic crRNA guides to form a duplex with Alt-R® CRISPR-Cas9 tracrRNA, ATTO 550 (IDT) and coupled to the Alt-R© S.p. Cas9 Nuclease V3 following IDT instructions for “Cationic lipid delivery of CRISPR ribonucleoprotein complexes into mammalian cells.” Transfection was performed using Lipofectamine CRISPRMAX reagent (Thermo Fisher Scientific) with a lower volume than the company’s protocol (with the ratio of 0.05 to RNP) and Cas9 PLUS Reagent (Thermo Fisher Scientific) was used in order to improve transfection. The transfected cells were incubated for 48 h. Single ATTO550+ cells were then sorted into 96-well plates. Clones were expanded and individually verified by Sanger and MiSeq sequencing of the target loci. In order to generate NSD1-KO isogenic lines, two guide sites were targeted simultaneously (guide 1 in PWWP domain: GCCCTATCGGCAGTACTACG and guide 2 in SET domain: GTGAATGGAGATACCCGTGT). The primer sequences used for screening the PWWP target region are F- TGTTTCCAGACAGTCTTCTTTGG and R- AAAGCCTTTTTCGTTTCCTACC, and those for screening the SET target regions are F- CACAGCAGAGGTCTCAGGAA and R- GTGGTGATGGTTGCACAAAA (key resources table ).
9
CRISPR-Mediated SULF1 Knockout in HS27A Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Gene Knockout Kit for was purchased from Synthego (CA, USA), which included single guide RNAs (sgRNAs) for SULF1, Cas9 enzyme (Streptococcus pyogenes) and a validated sgRNA for RELA to serve as a positive control. The kit was used to deliver the sgRNA-Cas9 ribonucleoproteins (RNPs) to HS27A cells with Lipofectamine CRISPRMAX reagent (ThermoFisher; L3000001), according to the protocol provided by Synthego. Reverse transfection was the method of choice for delivery of Lipofectamine-RNP complexes, which were added to wells of 12-well plates, followed by the addition of HS27A in suspension, at 80-100,000 cells/well or 20-25,000 cells/cm 2 .
mRNA was isolated 48h post-transfection, and qPCR was performed for gene expression analysis. Also at the 48h time-point, other replicate groups were used for isolation and expansion of multiple monoclonal populations via limiting dilution, until we obtained the SULF1 knockout HS27A line. Potential clones were screened through qPCR, in addition to the tool Inference of CRISPR Edits (ICE) developed by Synthego (https://ice.synthego.com) (Fig. S9).
mRNA was isolated 48h post-transfection, and qPCR was performed for gene expression analysis. Also at the 48h time-point, other replicate groups were used for isolation and expansion of multiple monoclonal populations via limiting dilution, until we obtained the SULF1 knockout HS27A line. Potential clones were screened through qPCR, in addition to the tool Inference of CRISPR Edits (ICE) developed by Synthego (https://ice.synthego.com) (Fig. S9).
10
Engineered Knockout Cell Lines via CRISPR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate knockout lines of Cal27, Detroit 562, and FaDu cell lines, CRISPR-Cas9 editing was performed using the Alt-R CRISPR-Cas9 System (IDT) and designing synthetic crRNA guides to form a duplex with Alt-R® CRISPR-Cas9 tracrRNA, ATTO™ 550 and coupled to the Cas9 Nuclease V3 following IDT instructions for "Cationic lipid delivery of CRISPR ribonucleoprotein complexes into mammalian cells".
Transfection was performed using Lipofectamine CRISPRMAX reagent (Thermo Fisher Scientific) with a lower volume than the company's protocol (with the ratio of 0.05 to RNP) and Cas9 PLUS Reagent (Thermo Fisher Scientific) was used in order to improve transfection. The transfected cells were incubated for 48 h. Single ATTO550+ cells were then sorted into 96-well plates. Clones were expanded and individually verified by Sanger and MiSeq sequencing of the target loci. Guide sites sequence for NSD1 KO: guide 1 in PWWP domain: GCCCTATCGGCAGTACTACG; guide 2 in SET domain:
GTGAATGGAGATACCCGTGT.
Transfection was performed using Lipofectamine CRISPRMAX reagent (Thermo Fisher Scientific) with a lower volume than the company's protocol (with the ratio of 0.05 to RNP) and Cas9 PLUS Reagent (Thermo Fisher Scientific) was used in order to improve transfection. The transfected cells were incubated for 48 h. Single ATTO550+ cells were then sorted into 96-well plates. Clones were expanded and individually verified by Sanger and MiSeq sequencing of the target loci. Guide sites sequence for NSD1 KO: guide 1 in PWWP domain: GCCCTATCGGCAGTACTACG; guide 2 in SET domain:
GTGAATGGAGATACCCGTGT.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!