Azure c500 system

The ChIP assay performed in this study was adapted from previously reported methods and with assistance from members of the Oestreich laboratory [12 (link),19 (link)]. In brief, chromatin was harvested from GBM12, GBM14, and GBM22 cells and immunoprecipitated with 5 µg of antibodies to p53 (DO-1) (Santa Cruz sc-126X) or a mouse IgG control (Santa Cruz SC-2025). Roughly 10 ng/µL of precipitated DNA was analyzed with gene-specific primers (SLC7A11 forward: 5′- AGGCTTCTCATGTGGCTGAT -3′, and reverse, 5′- TGCATCGTGCTCTCAATTCT -3′; p21 forward: 5′- CTTTCACCATTCCCCTACCC -3′, and reverse. 5′- AATAGCCACCAGCCTCTTCT -3′; human control HSPA6 forward: 5′- AGGAGAGGACTTCGACAACCG -3′ and reverse, 5′- CAGGTCCTTCCCATGCTTCC -3′) by RT-PCR with GoTaq (Promega M7123), according to the manufacturer’s instructions and as previously detailed [12 (link)]. For each RT-PCR reaction, 10 ng of DNA was amplified and analyzed on a 1% agarose gel. Images were captured with the Azure c500 system (Dublin, CA, USA).

Prepped cell lysates were separated by SDS-PAGE using 10% or 12.5% gels. Protein sizes were estimated using the PrecisionPlus All Blue protein marker (Bio-Rad, USA). Gels were incubated in Bjerrum Schafer-Nielsen transfer buffer and proteins were transferred to water-activated nitrocellulose membranes (Amersham Protran Premium 0.45 NC, GE Healthcare Life Sciences, Sunnyvale, USA) using semi-dry transfer (Trans-Blot® Turbo™, Bio- Rad, USA). Next, the membranes were stained in Ponceau solution for 5 min and scanned to be used as a loading control. The membranes were blocked in 5%-10% skim milk in TBS-T (Fluka, Taufkirchen, Germany) for 1 h at RT. After blocking, the membranes were incubated with the respective primary antibodies diluted in 1% Bovine Serum Albumin (BSA) or 5% skim milk overnight at 4 °C with gentle agitation. Next, the membranes were rinsed 3 × 5 min with TBS-T, incubated 1 h at RT with HRP-conjugated secondary antibodies (R&D Systems) followed by rinsing 3 × 5 min with TBS-T. Chemiluminescence was detected using an ECLplus kit (GE Healthcare, Amersham™) and an Azure c500 system (Azure Biosystems, Dublin, USA). Protein band quantification was carried out using ImageJ software (NIH, http://rsb.info.nih.gov/ij/). All antibodies used are listed in Supplementary Table 5.