Sepasol rna 1 super g reagent

The tibialis anterior (TA) muscles from untreated and immobilized mice were harvested and minced. Total RNA was isolated using Sepasol-RNA I Super G reagent (Nacalai Tesque), according to the manufacturer’s instructions. Total RNA was reverse-transcribed using ReverTra Ace Reverse Transcriptase (Toyobo, Osaka, Japan). PCR and quantification were performed using the Thunderbird qPCR Mix (Toyobo) and a 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). Gene transcript levels were normalized to the expression levels of Actb transcripts. The following primers were used: Fbxo32 (forward: TCTCCAGACTCTCTACACATCC; reverse: GAATGGTCTCCATCCGATACAC), Trim63 (forward: TACGTTGGTGCGAAATGAAA; reverse: AATCGCCAGTCACACAATGA), Il-33 (forward: ACTATGAGTCTCCCTGTCCTG; reverse: ACGTCACCCCTTTGAAGC), Il1rl1 (forward: TCTGTGGAGTACTTTGTTCACC; reverse: TCTGCTATTCTGGATACTGCTTTC), and Actb (forward: CTGAACCCTAAGGCCAACCGTG; reverse: GGCATACAGGGACAGCACAGCC). Because of the easier availability of young mice, more animals were used in the analysis for young mice than for aged mice.

The total RNA was extracted from the cell lines using Sepasol RNA-I Super G reagent (Nacalai Tesque Inc., Kyoto, Japan), and the cDNA was prepared using 2 μg of total RNA oligo-dT primers and Reverse Transcriptase (Toyobo Life Science Department, Osaka, Japan). The primers to carry out RT-PCR were previously reported [23 (link)]. RT-PCR was performed under the following conditions: cycles between 26 to 35, denaturation at 94 °C for 30 s, annealing at 65 °C for 30 s, elongation at 72 °C for 1 min, and extension at 72 °C for 5 min. The mRNA expression was normalized by the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA expression.

Total RNA was extracted from the kidney using the RNAlater (Thermo Fisher Scientific, Waltham, MA, USA) and the Sepasol-RNA I Super G reagent (Nacalai Tesque) according to the manufacturer’s instructions. The cDNA was synthesized from 1 mg total RNA using ReverTra Ace qPCR RT Master Mix (Toyobo, Osaka, Japan). Real-time PCR was performed with the SsoAdvanced SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) on a Mini-Opticon (Bio-Rad) according to the manufacturer’s protocols. All data were normalized to the level of the housekeeping gene β-Actin/Actb. The following primers were used for the analysis: Actb, forward, 5′-GCC CTA GGC ACC AGG GTG TGA-3′, and reverse, 5′-TCC TCA GGG GCC ACA CGC A-3′; Epo, forward, 5′-TCA TCT GCG ACA GTC GAG TTC TG-3′, and reverse, 5′-GGT ATC TGG AGG CGA CAT CAA TTC-3′; and Vegfa, forward, 5′-GCA GCT TGA GTT AAA CGA ACG-3′, and reverse, 5′-GGT TCC CGA AAC CCT GAG-3′.

Caco-2 cell monolayers grown in 12-well plates (Corning Incorporated, Kennebunk, ME, USA) were serum-starved overnight, incubated in the presence of (0,1, 10, 100 µM) trans-ferulic acid or 1/2 volume of culture supernatants from Bacteroides intestinalis, and after 1 h, Escherichia coli lipopolysaccharide (LPS) was added at a final concentration of 10 µg/mL. Culture media were collected 24 h after ferulic acid administration to determine IL-12p70, interferon (IFN)α, and IFNβ by commercially available enzyme-linked immune sorbent assay kits (R&D Systems, Minneapolis, MN). Total RNA from Caco-2 cells at 24 h was isolated using Sepasol-RNA I Super G reagent (Nacalai). The RNA concentration and purity were determined by UV absorption at 260:280 nm using an Ultrospec 1100 pro UV/Vis spectrophotometer (Amersham Biosciences, NJ). RNA was reverse-transcribed into cDNA using a ReverTra Ace qPCR RT kit (TOYOBO, Osaka, Japan), according to the manufacturer’s protocol, and then the DNA was amplified by PCR using Quick Taq HS DyeMix (TOYOBO). The sequences of the primers and the number of PCR cycles are listed in Table 1. The PCR products were separated on a 2% agarose gel containing 0.01% ethidium bromide. The amount of mRNA was normalized against the glyceraldehyde 3-phosphate dehydrogenase mRNA.

We extracted total RNA from cells or lung tissue using Sepasol RNA-I Super G reagent (Nacalai Tesque Inc., Kyoto, Japan), synthesized cDNA from 2 μg of total RNA with oligo-dT primer and ReverTra Ace Reverse Transcriptase (Toyobo Life Science Department, Osaka, Japan) and then performed standard PCR using primers described in Supplementary Table 5. PCR was performed with 26 to 35 cycles depending on the gene, denaturation at 94 °C for 30 s, annealing at 65 °C for 30 s, elongation at 72 °C for 1 min followed by a further extension at 72 °C for 5 min^{67 (link)}. The expression of mRNA was normalized against the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA expression.

Adrenal glands of sham-operated rats and adrenocortical autografts were quickly removed. The removed adrenal tissues were isolated from the surrounding fat and muscle tissues as much as possible, and total RNA was extracted using Sepasol-RNA I Super G reagent (Nacalai Tesque, Inc., Kyoto, Japan). Cyp11b1 and Cyp11b2 mRNAs in each sample were hybridised with the target probes (Supplementary Table 2) and reporter tags (Elements XT TagSet system, NanoString Technologies, Inc. N Seattle, WA). After trapping, the RNA copy number was counted in a digital analyser with the nCounter system (NanoString Technologies, Inc. N Seattle, WA) according to the provided manual. We analysed the data using nSolver analysis software (NanoString Technologies, Inc. N Seattle, WA). Each mRNA count was normalised to Hprt1 as the internal control gene. Background subtraction was performed using the raw counts of RNase-free water.