High capacity cdna reverse transcription kit

SH-SY5Y cells (2×10⁶ in a 60-mm culture plate) after treatment with GNPs (100 µg/mL) were lysed using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and total RNA extracted. Purity and concentration of the isolated RNA were determined by nanodrop spectrophotometer (ND-1000; Thermo Scientific, South San Francisco, CA, USA) at an absorbance of 260 nm. RNA samples were stored at −20°C. For real-time polymerase chain reaction (RT-PCR), complementary DNA (cDNA) was synthesized by high-capacity cDNA Reverse Transcription Kit (Sigma-Aldrich). Relative quantitation with RT-PCR was done for apoptotic genes Bax-TCTGACGGCAACTTCAACTG, TTGAGGAGTCTCACCCAACC and Bcl2-GGATGCCTTTGTGGAACTGT, AGCCTGCAGCTTTGTTTCAT using applied biosystems-sequence detection system (PE Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instruction. RT-PCR consisted of initial denaturing for 10 min at 95°C, 40 cycles of 95°C for 15 s, and 50°C for 1 min. Each sample was assayed in triplicates and the cycle threshold (CT) values were normalized to the housekeeping gene GAPDH and the fold change was calculated using 21CT method.21 (link)

To detect the expression of mi-R4435-2HG and ROCK2, RNAzol reagent (Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) was used to extract total RNA. Applied Biosystems™ High-Capacity cDNA Reverse Transcription kit was used to perform reverse transcription (25°C for 5 min, 55°C for 20 min and 75°C for 5 min) and SYBR^® Green Quantitative RT-qPCR kit (Sigma-Aldrich; Merck KGaA) was used to prepare PCR reaction systems. Reaction conditions were: 95°C for 1 min, 40 cycles of 95°C for 20 sec and 57°C for 50 sec. Primers of mi-R4435-2HG and ROCK2 as well as endogenous control GAPDH were designed and synthesized by Shanghai GenePharma Co., Ltd., (Shanghai, China). StepOnePlus real-time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) was used to carry out all PCR reaction systems. Primer sequences were: 5′-GTAACCCGTTGAACCCCATT-3′ (forward) and 5′-CCATCCAATCGGTAGTAGCG-3′ (reverse) for 18S rRNA; 5′-GTGTAGGAGAGTCGGCCTTC-3′ (forward) and 5′-TTGGGCTGGGATAGTGTCT-3′ (reverse) for mi-R4435-2HG; 5′-TGAAGGTCGGAGTCAACGGATTTGGT3′ (forward) and 5′-CATGTGGGCCATGAGGTCCACCACforGAPDH; 5′-GTGTCGGCTCCTCTGATCTC-3′ (forward) and 5′-GGCATGTCTGGATGACCTCT-3′ (reverse) for ROCK2. Cq values were normalized using 2^−∆∆Cq method (13 (link)).

Total RNA was isolated by a combination of two methods. First, total RNA was isolated from the blood samples using the Trizol method (Thermo fisher scientific). RNA was dissolved in diethylpyrocarbonate (DEPC)-treated, RNase-free, water. Purity was tested nanodrop and considered suitable for further processing at 260/280 ratios of 2. Total RNA was converted to single-stranded cDNA using a high-capacity cDNA reverse transcription kit (Sigma Aldrich) composed of reverse transcriptase (RT) buffer, RT random primers, dNTP mix, reverse transcriptase, and RNase-free H₂O.