Rnaeasy mini rna isolation kits

Total RNA was isolated from synovial fibroblasts and HMVECs using RNAeasy mini RNA isolation kits in conjunction with QIAshredders (Qiagen, Valencia, CA, USA) following the manufacturer’s protocol. Following isolation, RNA was quantified and checked for purity using a Nanodrop spectrophotometer (Thermo Fisher Scientific). cDNA was then prepared using a Verso cDNA kit (Thermo Fisher Scientific) as per the manufacturer’s protocol. Quantitative PCR (qPCR) was performed using Platinum SYBR Green qPCR SuperMix-UDG (Thermo Fisher Scientific) following the manufacturer’s protocol. The primer pairs used were based on published sequences. Diluted cDNA was mixed with Platinum SYBR Green qPCR SuperMix-UDG, forward and reverse primers specific for each gene (10 μM final concentrations), and incubated at the following cycles; 50 °C for 2 min, 95 °C for 2 min and 40 cycles of 95 °C for 30 s, 55 °C for 30 s and 68 °C for 30 s using an ABI Prism 7500 sequence detection system (Applied Biosystems, Foster City, CA, USA). The primers for human Id1 [25 (link)], are forward: AGAACCGCAAGGTGAGCAA and reverse: CCAACTGAAGGTCCCTGATGTAG. The primers used for β-actin were used previously, [12 (link), 26 (link)] and are forward: GCTAGGCAGCTCGTAGCTCT and reverse: GCCATGTACGTTGCTATCCA. All samples were run in duplicate.

Total RNA was isolated from HMVECs and EPCs using RNAeasy mini RNA isolation kits in conjunction with QIAshredders (Qiagen, Valencia, CA, USA) following the manufacturer’s protocol. Following isolation, RNA was quantified and checked for purity using a spectrophotometer (Nanodrop Technologies, Wilmington, DE, USA). cDNA was then prepared using a Verso cDNA kit (Thermo Fisher Scientific) as per the manufacturer’s protocol. Quantitative PCR (qPCR) was performed using Platinum SYBR Green qPCR SuperMix-UDG (Life Technologies, Carlsbad, CA, USA) following the manufacturer’s protocol. The primer pairs used were based on published sequences. Diluted cDNA was mixed with Platinum SYBR Green qPCR SuperMix-UDG, forward and reverse primers specific for each gene (10 μM final concentrations), and incubated at the following cycles; 50°C for 2 minutes, 95°C for 2 minutes and 40 cycles of 95°C for 30 sec, 55°C for 30 sec and 68°C for 30 sec using an ABI Prism 7500 sequence detection system (Applied Biosystems). The primers for human Id1 [23 (link)], are forward: AGAACCGCAAGGTGAGCAA and reverse: CCAACTGAAGGTCCCTGATGTAG. The primers used for β-actin were the same as we used previously [24 (link)], and are forward: GCTAGGCAGCTCGTAGCTCT and reverse: GCCATGTACGTTGCTATCCA. All samples were run in duplicate.

RA FLS were incubated in six-well plates in 0.1% BSA RPMI medium overnight, before stimulation with TNF-α (R&D Systems, 10 ng/ml). Total RNA was isolated from RA FLS using RNAeasy mini RNA isolation kits in conjunction with QIAshredders (Qiagen, Valencia, CA, USA) following the manufacturer’s protocol. Following isolation, RNA was quantified and checked for purity using a spectrophotometer (Nanodrop Technologies, Wilmington, DE, USA). cDNA was then prepared using a Verso cDNA kit (Thermo Fisher Scientific, Waltham, MA, USA) as per the manufacturer’s protocol. Quantitative PCR (qPCR) was performed using Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol. All samples were run in duplicate and using Eppendorf software.