Nonspecific control

Chemically synthesized c-myc- and C/EBPα-specific small interfering RNA (siRNA) and nonspecific control were purchased from RiboBio Co., Ltd. (Guangzhou, China). The sequences of the c-myc siRNAs were 5′-CTATGACCTCGACTACGAC-3′ and 5′-CTCGGTGCAGCCGTATTTCTA-3′, and the C/EBPα siRNA sequences were 5′-CCAAGAA GUCGGUGGACAADTDT-3′ and 5′-CGACGAGTTC CTGGCCGAC-3′. We purchased cholesterol-conjugated miR-122 mimic and negative control from Ribobio (Guangzhou, China) for RNA delivery in vivo. Reagents and antibodies were obtained as follows: hIL-6 (recombinant human Interleukin 6) and hTNFα (recombinant human tumor necrosis factor α) were purchased from Sinobio Biotechnology Co., Ltd. Shanghai China; DNase I (RNase-free) was purchased from Invitrogen; the Superscript RT reagent kit was from TaKaRa Bio Inc., Shiga, Japan; rabbit anti-human C/EBPα (sc-61 X) and mouse anti-c-myc (sc-40) monoclonal antibodies were from Santa Cruz Biotechnology; rabbit IgG was from Sigma; mouse anti-human actin, GAPDH and horseradish peroxidase (HRP)-conjugated secondary antibodies were purchased from Zhongshan Goldenbridge Biotechnology, China; the ECL-Plus chemiluminescence system was from Applygen Technologies, Beijing, China.

Asynchronously growing cells were seeded in 6-well plates at 2 × 10⁵ cells/well. Hsa-miRNA-30a mimic, hsa-miRNA-30a inhibitor, and nonspecific control were purchased from RiboBio (Guangzhou, China). Transfections were performed using the Lipofectamine 2000 Kit (Invitrogen) according to the manufacturer’s instructions.

The chemically synthesized cyclin G1-specific siRNA, miR-122 mimic, and non-specific control, as well as the miR-122 inhibitor and non-specific control, were purchased from RiboBio Co., Ltd. (Guangzhou, China). The sequences of the cyclin G1 siRNA was: sense, 5’-TGTCCCATTGGCAACTGAC dTdT; antisense, 5’-GUCAGUUGCCAAUGGGACA TdTd. Rabbit anti-human cyclin G1 (clone F-5) was from Santa Cruz Biotechnology.

Chemically synthesized short interfering RNA (siRNA) and a nonspecific control were purchased from RiboBio Co. Ltd. (Guangzhou, China). PRPF19-specific shRNA with the following target site was cloned in the lentiviral vector pLKO.1-puro (Addgene, catalog no. 8453). shPRPF19: 5′- CCGGGAACGGATGTGGAAGGAAGAACTCGAGTTCTTCCTTCCACATCCGTTCTTTTTG-3′ and 5′- AATTCAAAAAGAACGGATGTGGAAGGAAGAACTCGAGTTCTTCCTTCCACATCCGTTC-3′.

SFRP1 and β‐actin antibody were purchased from Abcam (Cambridge, UK). MiR‐542‐3p mimic/inhibitor/inhibitor mutant and non‐specific control were obtained from RiboBio (Gua ngzhou, China). Lipofectamine 2000 was purchased from Invitrogen.

MiR-9 mimics, non-specific control, miR-9 inhibitor, and random sequence were all purchased from RiboBio (Guangzhou, China). Cells were transfected at 40-60% confluence using Neofect siRNA transfection reagent (Neofect Tech, Beijing, China).

To generate knocking down USP8 cell lines, chemically synthesized short interfering RNA (siRNA) and a nonspecific control were purchased from RiboBio Co. Ltd. (Guangzhou, China). The siUSP8 sequences are as follows: sense, #1: GCATAAAGGTGAAGTGGCA; #2: GAAAACAGGAAGAGAGGAT; #3: GCAAAGAGGGGCAAAGAAA.