VSMCs were placed in 6‐well plates and grown to 80% confluence and then treated with FBS‐free medium containing 20 μg/mL of FC‐EVs for 0 minutes, 15 minutes, 30 minutes, 1 hour, or 2 hours. The total RNA was extracted from VSMCs using TRIzol (Thermo Scientific), and first‐strand cDNA was prepared using the TransScript RT enzyme (TransGen Biotech). Primer sets specific for integrin β1, integrin α5, and GAPDH were used to direct the polymerase chain reaction (94°C for 5 minutes and 40 cycles of 94°C for 30 seconds, 60°C for 30 seconds, and 72°C for 30 seconds, and then 72°C for 5 minutes). The linear expression range of each gene was determined by serial dilutions of each cDNA pool and normalized to the expression of GAPDH. The forward and reverse primer sequences were as follows: CAAGAGAGCTGAAGACTATCCCA and TGAAGTCCGAAGTAATCCTCCT for integrin β1, GCCTGTGGAGTACAAGTCCTT and AATTCGGGTGAAGTTATCTGTGG for integrin α5, and GGAGCGAGATCCCTCCAAAAT and GGCTGTTGTCATACTTCTCATGG for GAPDH.
Transscript rt enzyme
Manufactured by Transgene
Sourced in China
TransScript RT enzyme is a reverse transcriptase enzyme used for the synthesis of complementary DNA (cDNA) from RNA templates. The enzyme possesses RNA-dependent DNA polymerase activity, allowing it to transcribe RNA into cDNA. This essential function supports various molecular biology applications that require the conversion of RNA to DNA for further analysis or manipulation.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using transscript rt enzyme
1
Integrin Expression in VSMCs Treated with FC-EVs
2
Mitochondrial DNA Copy Number Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mtDNA copy number was analyzed by qPCR. Total RNA was extracted from VSMCs using TRIzol (#15596026, Thermo Scientific, Massachusetts, United States), and first-strand cDNA was prepared using the TransScript RT enzyme (AT411-02, TransGen Biotech, Beijing, China). qPCR was performed using 1,000 ng DNA as the starting material with the designed primers for the mitochondrial gene cytochrome oxidase subunit 1 (Forward: ATTGCCCTCCCCTCTCTACGCA; Reverse: CGTAGCTTCAGTATCATTGGTGCCC) and nuclear DNA products β-actin (Forward: CCATGTTCCAAAACCATTCC; Reverse: GGGCAACCTTCCCAATAAAT). Relative values of mitochondrial DNA products (COX-1) and nuclear DNA products (β-actin) in each sample were used.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!