Anti rela

Manufactured by Santa Cruz Biotechnology

Anti-RelA is a laboratory reagent used in research applications. It is a monoclonal antibody that specifically binds to the RelA subunit of the NF-κB transcription factor complex. The core function of Anti-RelA is to facilitate the detection and study of the RelA protein in various experimental settings.

Automatically generated - may contain errors

Lab products found in correlation

Anti actin, by Merck Group (2 mentions) Anti irf3, by Santa Cruz Biotechnology (2 mentions) Anti ha, by Merck Group (2 mentions) Anti phospho histone h2ax, by Cell Signaling Technology (2 mentions) Anti parp, by Cell Signaling Technology (2 mentions) Hrp conjugated secondary antibody, by Bio-Rad (1 mentions) Protease inhibitor cocktail, by Roche (1 mentions) Anti traf3, by Santa Cruz Biotechnology (1 mentions) Anti snrnp200, by Merck Group (1 mentions) Anti nhp2l1, by Abcam (1 mentions) Anti ddx3x, by Fortis Life Sciences (1 mentions) Anti ddx60, by Abcam (1 mentions) Western lighting chemiluminescence reagent plus, by PerkinElmer (1 mentions) Anti pak4, by Cell Signaling Technology (1 mentions) Veriblot, by Abcam (1 mentions) Secondary anti rabbit igg, by Cell Signaling Technology (1 mentions) Trypsin edta, by Merck Group (1 mentions) Anti p50, by Santa Cruz Biotechnology (1 mentions) Anti iκbα, by Cell Signaling Technology (1 mentions) Validated primer set, by Merck Group (1 mentions)

Close spelling variants of this product

Anti-RelA/p65 (8 citations) Rabbit anti-RelA (5 citations) Anti-RelA (sc-372, (4 citations) Anti-RelA antibody (2 citations) Anti-RelA (5G8) (2 citations)

9 protocols using anti rela

Comprehensive Cell Lysis and Immunoblotting

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were washed twice with ice-cold phosphate-buffered saline (PBS; Wisent), harvested and lysed in 10mM Tris-HCl, 100mM NaCl, 0.5% Triton X-100, pH7.6 with EDTA-free Protease Inhibitor Cocktail (Roche). Cell lysates were clarified by centrifugation at 13,000 g for 20 min at 4°C and subjected to sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE). Western blot analysis was performed using mouse anti-PHF5A (Abnova), anti-IRF3 (Santa Cruz), anti-TRAF3 (Santa Cruz), anti-RIG-I (Alexis Biochemicals), anti-ACTIN (Chemicon International), anti-TBK1 (Imgenex and Santa Cruz), anti-IKBKE (Santa Cruz), anti-TUBULIN (ICN), anti-GAPDH (RDI) and rabbit anti-SNRNP200 (Sigma-Aldrich), anti-SF3A1 (Santa Cruz), anti-RELA (Santa Cruz), anti-NHP2L1 (Abcam), anti-DDX3X (Bethyl), anti-DDX60 (Abcam), TRIF (Cell Signaling), anti-ISG56 (Novus Biologicals), anti-MDA5 (Alexis Biochemicals), anti-MAVS (Alexis Biochemicals), anti-IKBKE (eBioscience), STAT1 (ABCAM), STAT1 tyr701 (ABCAM), IFNAR1 (Santa Cruz) and anti-IRF3-P-ser386 (Abcam). HRP-conjugated secondary antibodies were from Bio-Rad. The chemiluminescence reaction was performed using the Western Lighting Chemiluminescence Reagent Plus (PerkinElmer).

Tremblay N., Baril M., Chatel-Chaix L., Es-Saad S., Park A.Y., Koenekoop R.K, & Lamarre D. (2016). Spliceosome SNRNP200 Promotes Viral RNA Sensing and IRF3 Activation of Antiviral Response. PLoS Pathogens, 12(7), e1005772.

+ Open protocol

+ Expand

Immunoblotting Protein Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Unless otherwise stated, general lab reagents were purchased from Sigma Aldrich and were of the highest quality available. The following primary antibodies were used for immunoblotting at 1/1000 dilution in 5% (w/w) BSA overnight at 4°C: anti-RelA (sc-372, Santa Cruz), anti-HA (Merck, HA-7), anti phospho-histone H2AX (#2577, Cell Signalling), anti-PAK4 (#3242, Cell Signaling Technologies), anti-Karyopherin-β1 H-7 (sc-137016, Santa Cruz). Secondary anti-rabbit IgG (7074S, Cell Signalling Technology) was used at 1/5000 dilution following membrane incubation with VeriBlot (1/400 dilution, ab131366 Abcam).

Campbell A.E., Ferraz Franco C., Su L.I., Corbin E.K., Perkins S., Kalyuzhnyy A., Jones A.R., Brownridge P.J., Perkins N.D, & Eyers C.E. (2021). Temporal modulation of the NF-κB RelA network in response to different types of DNA damage. Biochemical Journal, 478(3), 533-551.

+ Open protocol

+ Expand

RelA ChIP-seq Protocol for Transcriptional Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

After stimulation, cells were harvested at desired time points. ChIP-seq libraries were prepared using the NEB Next Ultra DNA Library Prep Kit for Illumina (New England Biolabs). ChIP-seq was performed as described (Barish et al., 2010 (link)) using anti-RelA (Santa Cruz Biotechnology, sc-372) antibody.

Sen S., Cheng Z., Sheu K.M., Chen Y.H, & Hoffmann A. (2020). Gene regulatory strategies that decode the duration of NFκB dynamics contribute to LPS- vs. TNF-specific gene expression. Cell systems, 10(2), 169-182.e5.

+ Open protocol

+ Expand

Nuclear Protein Extraction Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were trypsinized with trypsin-EDTA (Sigma), washed with PBS, and the cell pellet was resuspended in 1 ml of cold buffer A (10 mM HEPES, 1.5 mM MgCl₂, 10 mM KCl, 1 mM DTT). Nuclear pellets were isolated from the whole cell protein by centrifugation at 14,000 rpm for 1 min at 4°C and resuspended in two-thirds packed cell volume of cold buffer B (20 mM HEPES, 1.5 mM MgCl₂, 25% glycerol, 420 mM NaCl, 0.2 mM EDTA, 1 mM DTT) with vigorous agitation in the cold room for 30 min. The supernatant containing nuclear proteins was collected for Western blot. The following antibodies were used for blotting: anti-RelA (Santa Cruz), anti-IκBα (Cell Signaling), anti-PARP (Cell Signaling), anti-Actin (Sigma-Aldrich), and anti-p50 (Santa Cruz).

Hu G., Gong A.Y., Wang Y., Ma S., Chen X., Chen J., Su C.J., Shibata A., Strauss-Soukup J.K., Drescher K.M, & Chen X.M. (2016). LincRNA-Cox2 Promotes Late Inflammatory Gene Transcription in Macrophages through Modulating SWI/SNF-mediated Chromatin Remodeling. Journal of immunology (Baltimore, Md. : 1950), 196(6), 2799-2808.

+ Open protocol

+ Expand

ChIP Assay for Transcription Factor Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols

ChIP assay was done as previously described (Jacob et al, 2011). Briefly, fibroblasts were cross‐linked in 1% formaldehyde for 10 min at RT followed by glycine quenching. Cells were then washed and lysed, and the chromatin was sonicated into 200‐ to 1,000‐bp fragments, diluted, and pre‐cleared using protein A beads. Anti‐Rel‐A‐ (Santa Cruz) or isotype‐matched IgG (control) antibodies were incubated with the chromatin samples overnight. Protein A beads were added for 2 additional hours, and the beads were then washed and the cross‐linked reversed overnight at 65°C. The DNA was purified and subjected to quantitative PCR analysis using the indicated primers. The dissociation curves following amplification showed that all primer pairs generated single products. The amount of PCR product amplified was calculated relative to the input.
Primers:

hTNFA promoter: For: CCTCCAGATGAGCTCATGGGTT, Rev: GGGTGTGCCAACAACTGCCTTT.

hIL1B promoter: For: TGTCTTCCACTTTGTCCCACA, Rev: CGTTGTGCAGTTGATGTCCA.

hp21 promoter: Validated primer set was purchased from Millipore.

hIKB promoter: Validated primer set were purchased from Millipore.

Falik‐Zaccai T.C., Barsheshet Y., Mandel H., Segev M., Lorber A., Gelberg S., Kalfon L., Ben Haroush S., Shalata A., Gelernter‐Yaniv L., Chaim S., Raviv Shay D., Khayat M., Werbner M., Levi I., Shoval Y., Tal G., Shalev S., Reuveni E., Avitan‐Hersh E., Vlodavsky E., Appl‐Sarid L., Goldsher D., Bergman R., Segal Z., Bitterman‐Deutsch O, & Avni O. (2017). Sequence variation in PPP1R13L results in a novel form of cardio‐cutaneous syndrome. EMBO Molecular Medicine, 9(3), 319-336.

+ Open protocol

+ Expand

Western Blot Analysis of Cellular Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Protein lysates were prepared and loaded on SDS/PAGE gel and transferred onto nitrocellulose membrane. Transferred proteins were subjected to immunoblotting with the indicated antibodies. The primary antibodies used in this study were as follows: anti-Vinculin (Sigma, 1:20000), anti-GAPDH (Santa Cruz, 1:1000), anti-Caspase-3 (Cell signaling, 1:1000), anti-cleaved Caspase-3 (Cell signaling, 1:1000), anti-PARP (Cell signaling, 1:1000), anti-cleaved PARP (Cell signaling, 1:1000), anti-BAX (Cell signaling, 1:1000), anti-4EBP1 (Cell signaling, 1:1000), anti-phospho-4EBP1 (Cell signaling, 1:1000), anti-p70 S6 Kinase (Cell signaling, 1:1000), anti-Phospho-p70 S6 Kinase (Thr389) (Cell signaling, 1:1000), anti-RELA (Santa Cruz, 1:1000), anti-phospho-RELA (S536, 1:1000) (Cell signaling), anti-interleukin 6 (R&D systems, 1:400). HRP-conjugated anti-mouse IgG and anti-rabbit IgG secondary antibodies were obtained from the Jackson ImmunoResearch Laboratories Inc.

Kim E.J., Woo J., Shin S., Choi H., Kim Y., Kim J, & Kang C. (2022). A focused natural compound screen reveals senolytic and senostatic effects of Isatis tinctoria. Animal Cells and Systems, 26(6), 310-317.

+ Open protocol

+ Expand

Nuclear Protein Complex Isolation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cell pellets were resuspended in 1 ml lysis buffer (10 mM Tris-HCl pH7.4, 10 mM NaCl, 3 mM MgCl₂, 0.5% NP-40 and cocktail protease inhibitor) and nuclei were collected by centrifugation (500 g, 5 min) with the lysis buffer devoid of NP-40. A total of 600 μg nuclear protein was incubated with the primary antibodies at 4°C overnight to immunoprecipitate the protein complexes in the presence or absence of 100 micrograms per ml ethidium bromide. Immune complexes were collected by direct binding to protein A Agarose. The following antibodies were used for IP/Co-IP analysis: anti-RelA (Santa Cruz), anti-MyBBP1A (Santa Cruz), anti-BAF170 (Cell Signaling), anti-Brg1 (Santa Cruz), and anti-RelB (Santa Cruz).

+ Open protocol

+ Expand

ChIP-seq Protocol for Transcription Factors

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

ChIP-seq libraries were prepared using the Kapa LTP Library Preparation Kit (Kapa Biosystems). ChIP-seq was performed as described (Barish et al., 2010 (link); Lee et al., 2006 (link)) with minor modifications, using anti-RelA (Santa Cruz, sc-372), anti-IRF3 (Santa Cruz, sc-9082), or anti-SRF (Santa Cruz, sc-335) antibodies.
Reads were aligned to the mouse genome (NCBI37/mm9) with Bowtie2. Uniquely mapped reads were used for peak calling and annotation using HOMER (Heinz et al., 2010 (link)). Peaks were called if they passed a false discovery rate of 0.01 and were enriched over input. Called peaks were considered for downstream analysis if peaks from at least 4 of 7 replicates were overlapping within 200 bp for RelA and 5 of 5 replicates were overlapping within 300 bp for SRF. Peaks were annotated to the nearest TSS.

Tong A.J., Liu X., Thomas B.J., Lissner M.M., Baker M.R., Senagolage M.D., Allred A.L., Barish G.D, & Smale S.T. (2016). A Stringent Systems Approach Uncovers Gene-Specific Mechanisms Regulating Inflammation. Cell, 165(1), 165-179.

+ Open protocol

+ Expand

Immunoprecipitation and Mass Spectrometry Protocol for Protein Complexes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Pierce™ Anti-HA Magnetic Beads were washed with 0.05% (v/v) TBST and then with lysis buffer prior to addition of 4 mg cleared cell lysate (at a ratio of beads to protein of 1:2000).
Beads and lysate were incubated overnight using an end-over-end rotor at 4°C. Beads were then collected using a magnetic stand and washed three times with 40 mM Tris-HCl pH 8.0, 0.1% (v/v) NP-40, 1 mM EGTA, 6 mM EDTA, 6 mM DTT, 0.5 M NaCl, 1 x PhosSTOP™ phosphatase inhibitor cocktail tablet (Roche), 1 x cOmplete™ Protease Inhibitor Cocktail (Roche); one time with HPLC grade water and finally, three times with 25 mM ammonium bicarbonate (AMBIC). To recover the immunoprecipitated material, the beads were resuspended in 100 μL of 25 mM AMBIC to which 6 μL of a 1% (w/v) solution of RapiGest (Waters, UK) in 25 mM AMBIC was added. Samples were then heated to 80 °C for 10 min.
Supernatants containing the eluted proteins were recovered using a magnetic stand and used for in-solution digestion. For western blots the following antibodies were used: Anti-RelA (SC-372, Santa Cruz), Anti-HA (Merck, HA-7), Anti phospho-histone H2AX (2577, Cell Signalling).

Campbell A., Franco C., Su L., Perkins S., Jones A.R., Brownridge P., Perkins N.D., & Eyers C.E. (2020). Temporal modulation of the NF-κB RelA network in response to different types of DNA damage.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!