Qiaamp dna paraffin embedded tissue kit

Thirty serial sections (5 μm thick per section) of each CK20 positive and CK20 negative PELS as detected from IHC staining were cut. Microtome was cleaned with xylene before sectioning of each specimen in order to avoid any tissue carryover. Each section was mounted on a superfrost slide. The unstained sections of each specimen were deparaffinized with xylene followed by absolute alcohol. Selected areas on each slide were circled by comparing with a reference IHC stained slide of the same tissue section. Circled areas on each slide were filled with buffer ATL (Qiagen, Hilden, Germany) followed by scrapping using a new scalpel for each tissue specimen. The scrapped tissues were then transferred into an RNase-free microcentrifuge tube and the final volume was made up to 180 μl using buffer ATL. DNA extraction was performed according to instructions of a QIAamp DNA paraffin embedded tissue kit (Qiagen).

In all, 16 samples were analyzed by MS-PCR. Total DNA from paraffin-embedded tissues of parathyroid glands was extracted using the QIAamp DNA paraffin-embedded Tissue Kit (Qiagen), and genomic DNA was treated with bisulfite using the EZ DNA Methylation-Gold Kits (Zymo Research). All unmethylated cytosine residues in DNA were converted into uracil, with no influence on methylated cytosine. Specific primers for both methylated and unmethylated DNA sequences were used for the POMC promoter (Table 3). Subsequently, promoter methylation of the POMC gene was detected by MS-PCR. The amplification products were detected by 2% agarose gel electrophoresis, and PCR results were analyzed on a Gel Imager.Table 3

Primers for the POMC gene

Primer name	Primer sequences	Product size
POMC-M-F	TAGTTTTTAAATAATGGGGAAATCG	141 bp
POMC-M-R	AACAACCTCTAAAATCGTTAAAACG
POMC-U-F	ATAGTTTTTAAATAATGGGGAAATTG	140 bp
POMC-U-R	CAACCTCTAAAATCATTAAAACAAA