The largest database of trusted experimental protocols

Pmirglo expression vector

Manufactured by Tsingke
Sourced in China

The PmiRGLO expression vector is a plasmid designed for the expression of miRNA precursors in mammalian cells. It features a miRNA expression cassette and a reporter gene for monitoring expression.

Automatically generated - may contain errors

2 protocols using pmirglo expression vector

1

miR-152-5p Regulates ARHGAP6 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
The full-length 3' untranslated region (3'UTR) amplification products of the Rho GTPase-activating protein 6 (ARHGAP6) gene containing the binding sites of miR-152-5p predicted by the miRDB database were transferred into a pmiRGLO expression vector (Tsingke Biotechnology) to form ARHGAP6-wild-type (WT). Independently, a site-specific mutation targeting the predicted binding site for miR-152-5p in the ARHGAP6 gene was established, and the resultant mutant sequence was also introduced into a pmiRGLO expression vector to form ARHGAP6-MUT. Then, the H9c2 cardiomyocytes were co-transfected with a reporter plasmid and a miR-152-5p mimic or mimic-NC using Lipofectamine 2000. The ARHGAP6-WT- and ARHGAP6-MUT-transfected cells were each used to establish a blank control, miR-152-5p mimic and mimic-NC group with three duplicate wells in each group. After 48 h of culture, the luciferase activity of the cells was detected using a fluorescence microplate reader (Spark 10M; Tecan Group, Ltd.) according to the instructions of the Dual Luciferase Reporter Gene Assay Kit (RG008, Beyotime). The relative luciferase activity was calculated using the following equation: Relative luciferase activity=firefly luciferase activity value/Renilla luciferase activity value.
+ Open protocol
+ Expand
2

Targeting circMGAT5 and miR-132c-5p

Check if the same lab product or an alternative is used in the 5 most similar protocols
siRNAs targeted to circMGAT5 (si-circFGFR2, 5′-AGCTTAATGTAGCAGGATG-3′) or a non-specific siRNA negative control, miR-132c-5p mimic, mimic control duplexes, miR-132c-5p inhibitor, inhibitor control, the 3′ end biotinylated miR-132c-5p mimic (AGCCAUGACUGUAGACUGUUACU) and control duplexes used in this study were synthetized by RiboBio (Guangzhou, China).
For circMGAT5 overexpression plasmid construction, the linear sequence of circMGAT5 was amplified and cloned into the pCD25-ciR expression vector. For pmirGLO-circMGAT5-wild/pmirGLO-circMGAT5-mutant reporter and pmirGLO-MMD-wild/pmirGLO-MMD-mutant reporter construction, the corresponding wild sequence and the mutant sequence were synthetized by Tsingke Biotechnology (Beijing, China) and then cloned into the pmirGLO expression vector.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!