To construct the pMIR-ADAM19-3’UTR plasmid that contained the potential binding sites of the ADAM19 3’-UTR downstream of the firefly luciferase gene, a 282 bp sequence was amplified and inserted into the SpeI and HindIII sites of the pMIR-REPORT Luciferase vector(Ambion, Austin, TX, USA). The plasmid with the miR-30c target site deleted from the ADAM19 3’-UTR was also constructed. HEK293 and HCT116 cells were used to measure luciferase activity. When grew to 60–70% confluence, cells were co-transfected with 100 ng Luciferase plasmid and 50 ng Renilla plasmid (Ambion, Austin, TX, USA) along with 650 ng miR-30c mimic or NC as described above. After incubation for 48h at 37°C,the luciferase activity was detected with the Dual Luciferase Reporter 1000 Assay System (Promega, Madison, WI, USA).
Renilla plasmid
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Renilla plasmid is a laboratory tool used for gene expression studies. It contains the Renilla luciferase reporter gene, which can be used to measure the activity of a promoter or the expression of a gene of interest. The plasmid can be transfected into cells, and the Renilla luciferase activity can be quantified to provide a readout of the gene expression level.
Automatically generated - may contain errors
Lab products found in correlation
Dual luciferase reporter 1000 assay system, by Promega (4 mentions)
Pmir report luciferase vector, by Thermo Fisher Scientific (3 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Renilla plasmid, by Promega (1 mentions)
Dual luciferase reporter assay system, by Promega (1 mentions)
Pgl3 control vector, by Promega (1 mentions)
5 protocols using renilla plasmid
1
Constructing pMIR-ADAM19-3'UTR Luciferase Plasmid
2
Constructing pMIR-GNA13-3'UTR Luciferase Plasmid
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to construct the pMIR-GNA13-3′UTR plasmid containing the potential binding sites of the GNA13 3′-UTR, downstream of the firefly luciferase gene, a 275 bp sequence was inserted into the SpeI and HindIII sites of the pMIR-REPORT luciferase vector (Ambion; Thermo Fisher Scientific, Inc.) following amplification. A plasmid containing the GNA13 3′-UTR with the miR-30d target site deleted was also constructed. Luciferase activity was measured using SW480 cells. The cells were co-transfected with 100 ng luciferase plasmid and 50 ng Renilla plasmid (Ambion; Thermo Fisher Scientific, Inc.) using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) along with 650 ng miR-30d mimic or NC, when they grew to 60–70% confluence, according to the aforementioned method. The Dual Luciferase Reporter 1000 Assay system (Promega Corporation, Madison, WI, USA) was used to detect luciferase activity following incubation for 48 h at 37°C. Transfection efficiency was assessed using renilla luciferase activity and was normalized to firefly activity.
3
Luciferase Assay for miR-483-3p Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pMIR-SRF-3′ UTR plasmid containing the putative binding site of the SRF 3′UTR downstream of the firefly luciferase gene was generated by cloning and inserting of a 395 bp sequence located at 3′UTR downstream into the SpeI and HindIII sites of the pMIR-REPORT Luciferase vector (Ambion, TX, USA). For luciferase activity measurement, HEK293 T cells were grown in 24-well plates until 60–70 % confluence and co-transfected with 100 ng Luciferase plasmid and 50 ng Renilla plasmid (Ambion) as a control for transfection efficiency, along with 650 ng miR-483-3p agomir or antagomir or negative control. The activity of Luciferase and Renilla was assessed after 48 h with the Dual Luciferase Reporter 1000 Assay System (Promega, WI, USA).
4
Luciferase Assay for miR-142-3p Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Luciferase reporter assay was performed, as previously described [44 (link)], to explore the potential regulation mechanisms of miR-142-3p. For the measurement of luciferase activity, cells were cotransfected in 24-well plates with 100 ng of luciferase plasmid and 50 ng of Renilla plasmid (Ambion) as a control, as well as with 400 ng of miR-142-3p mimics or negative control microRNA. The luciferase and Renilla plasmid activities were measured 48 h later using the Dual Luciferase Reporter 1000 Assay System (Promega, Madison, WI, USA).
5
Validating miR-16 Regulation of IKKβ
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
miRNA target prediction tools, including TargetScan 7.0 (http://targetscan.org/ ) and miRanda (http://miranda.org ) were used to search for the putative targets of miR-16. A sequence containing miR-16 predicted target within the IKKβ 3′-untranslated region (UTR) CUCUUUUUAUUUCACUGCUGCU A or a mutant sequence lacking any complementarity with the miR-16 seed sequence CUCUUUUUAUUUCACACAGCAG A were inserted into pGL3 control vector (Promega Corporation) to generate the reporter vector pGL3-IKKβ 3′-UTR wild-type (wt) and pGL3-IKKβ 3′-UTR mutant (mut). When ESCs reached 60-70% conf1uence in a 24-well plate, 100 ng of Luciferase plasmid was co-transfected with 50 ng of Renilla plasmid (Ambion) and 650 ng of miR-16 mimics or mimics NC using Lipofectamine 2000. At 48 h post-transfection, the luciferase activities were analyzed using the Dual Luciferase Reporter Assay system (Promega Corporation).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!