Total RNA was isolated from liver, and kidney tissues using the RNeasy kit (Qiagen, Hilden, Germany), and the complementary DNA was synthesized using the First-Strand cDNA synthesis kit (Invitrogen, Carlsbad, USA). The quantitative PCR reaction was performed by using 1 μg of cDNA, and Brilliant qPCR Master Mix kit (Agilent, Santa Clara, USA). The sequences of primers and probes were listed: hypoxanthine guanine phosphoribosyltransferase (HPRT): GACCGGTTCTGTCATGTCG, ACCTGGTTCATCATCACTAATCAC, and Probe #95; TNF-α: TGAACTTCGGGGTGATCG, GGGCTTGTCACTCGAGTTTT, and Probe #63; IL-6: CCTGGAGTTTGTGAAGAACAACT, GGAAGTTGGGGTAGGAAGGA, and Probe #106; CCL2: AGCATCCACGTGCTGTCTC, GATCATCTTGCCAGTGAATGAG, and Probe #62; CCL3: GCGCTCTGGAACGAAGTCT, GAATTTGCCGTCCATAGGAG, and Probe #40. The standard curve was generated using a serial dilution of a normal sample. Gene expression was normalized using hypoxanthine guanine phosphoribosyltransferase (HPRT) [6 (link)], and the fold change was calculated using a normal liver tissue sample as reference sample.
Brilliant qpcr master mix kit
Manufactured by Agilent Technologies
Sourced in United States
The Brilliant qPCR Master Mix kit is a reagent designed for use in quantitative real-time PCR (qPCR) experiments. It contains essential components necessary for the amplification and detection of DNA sequences.
Automatically generated - may contain errors
3 protocols using brilliant qpcr master mix kit
1
Quantitative PCR Analysis of Immune Mediators
2
Quantitative Analysis of Hepatic Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from liver tissue using the RNeasy kit (Qiagen, Hilden, Germany) and quantified by using NanoDrop spectrophotometer (ND-100, PEQLAB, Erlangen, Germany). Complementary DNA was synthesized using 3 μg RNA (First-Strand cDNA synthesis kit, Invitrogen, Carlsbad, USA). Ten micrograms of cDNA was used for quantitative PCR reaction (Brilliant qPCR Master Mix kit, Agilent, Santa Clara, USA). The sequences of primers and probes were as follows: IL-6: CCTGGAGTTTGTGAAGAACAACT and GGAAGTTGGGGTAGGAAGGA (Probe #106), TNF-α: TGAACTTCGGGGTGATCG and GGGCTTGTCACTCGAGTTTT (Probe #63), TLR4: GGATGATGCCTCTCTTGCAT and TGATCCATGCATTGGTAGGTAA (Probe #95), MD2: TGATGATTATTCTTTTTGCAGAGC and ATCCCCAGCAATGGCTTC (Probe #75), and hypoxanthine guanine phosphoribosyltransferase (HPRT): GACCGGTTCTGTCATGTCG and ACCTGGTTCATCATCACTAATCAC (Probe #95). The gene expression fold changes were calculated using pooled liver samples from all groups as the reference sample.
3
Quantitative PCR of Liver RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from liver tissue using the RNeasy kit (Qiagen, Hilden, Germany). Complementary DNA synthesis was performed using the first-strand cDNA synthesis kit (Invitrogen, Carlsbad, Calif). An equal amount (1 μg) of cDNA was used for quantitative polymerase chain reaction (PCR) (Brilliant qPCR Master Mix kit, Agilent, Santa Clara, Calif). Thermal cycling conditions consisted of a 10-min template denaturation step at 95°C, followed by 50 cycles of 95°C for 30 s, 50°C for 30s, and 72°C for 30 s in M × 3000P QPCR system (Stratagene, La Jolla, Calif). The sequences of primers are shown in Table 2. Normal liver tissue was used as reference sample to generate the standard curve. Relative quantification of target messenger RNA expression was calculated and further normalized to housekeeping gene HPRT.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!