Cd133 fitc antibody

The NSCLC cell line PC9 was purchased from American Type Culture Collection (USA). For sorting the PC9-CSCs, the PC9 cells were stained with CD133-FITC antibody (Miltenyi Biotec, Germany) for 20 min at room temperature. Then the CD133⁺ PC9 cells were sorted as the PC9-CSCs on a FACS vantage (FACSCALIBUR, BD Biosciences, USA). In addition, the CD133⁻ PC9 cells were sorted and considered as the PC9-non-CSCs. Cells were cultured in DMEM basic medium (Gibco, USA) contained with 10% fetal bovine serum (Gibco) at 37°C in a humidified 5% CO2 incubator. To evaluate the role of miR-128 in vivo, the stable PC9 cell line overexpressed miR-128 was generated. Briefly, we purchased the recombinant lentivirus which contains miR-128 precusor sequence from the Shanghai Genechem Co., Ltd. (Shanghai, China). The precusor sequence of miR-128 is as follows: 5′-UGAGCUGUUGGAUUCGGGGC CGUAGCACUGUCUGAGAGGUUUACAUUUCUCACAGUGAACCGGUCUCUUUUUCAGCUGCUUC-3′. Then, 1 × 10⁴ PC9 cells were transfected with 5 × 10⁵ transducing units of lentivirus, and the cells were selected with 1 μg/ml puromycin for 2 weeks.