Anhydrochlortetracycline hcl

The PC‐3 human prostate carcinoma cell line was maintained in RPMI‐1640 media (Gibco), and LNCaP human prostate carcinoma cell line was maintained in RPMI‐1640 media (American Type Culture Collection). All media were supplemented with 10% fetal bovine serum (Gemini Bio), 100 U/mL penicillin, and 100 µg/mL streptomycin, and cells were maintained at 37°C with 5% CO₂. Cell lines were authenticated by Genetica DNA Laboratories (Burlington, NC). The constitutively‐active and inducible SBP1 expression constructs were introduced via transfection using Continuum Transfection Reagent (Gemini Bio) into PC‐3 cells, and PC‐3 cells that were previously infected with the tetracycline trans‐activator (TETON) construct,¹⁰ respectively. The same reagent was also used for the transfection of plasmids into LNCaP cells. Transfected cells were selected in 500 µg/mL G418 (Sigma‐Aldrich), and expanded and screened for SBP1 expression by Western blot analysis and quantiative real‐time polymerase chain reaction (qRT‐PCR) using SBP1 forward primer (5′‐CCAAAGCTGCACAAGGTCAT‐3′), SBP1 reverse primer (5′‐ CATCCAGCAGCACAAAACCC‐3′), RPLP0 forward primer (5′‐CCTCGTGGAAGTGACATCGT‐3′), and RPLP0 reverse primer (5′‐ CTGTCTTCCCTGGGCATCAC‐3′). Ectopic expression of SBP1 was induced following incubation with 0.5 µg/mL doxycycline or 0.05 µg/mL anhydrochlortetracycline‐HCl (Cayman Chemical) for 48 to 72 hours.