Log In Sign up
The largest database of trusted experimental protocols

Crispr lenti nontargeting control plasmid

Manufactured by Merck Group
Visit Supplier

The CRISPR-Lenti nontargeting control plasmid is a laboratory tool designed for CRISPR-Cas9 gene editing experiments. It does not target any specific genetic sequence and can be used as a control in CRISPR experiments.

Automatically generated - may contain errors

Lab products found in correlation

Max efficiency dh5α, by Thermo Fisher Scientific (1 mentions) Lenticrisprv2 vector, by GenScript (1 mentions)

2 protocols using crispr lenti nontargeting control plasmid

1

CRISPR-Lenti Knockout Protocol

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The gRNA sequences are included in Supplementary Table 9. These gRNAs were cloned into the LentiCRISPRv2 vector63 (link). CRISPR-Lenti nontargeting control plasmid was purchased from MilliporeSigma (Billerica, MA) (CRISPR12-1EA). MAX Efficiency DH5α (ThermoFisher Scientific, Cat# 18258012) were used to amplify plasmids. Lentiviruses were produced in the Viral Vector Core Laboratory of NIH/NIEHS or Baylor College of Medicine and were used to infect cells for the knockout of the specific gene. The pooled cells infected by gRNA were collected for western blot to confirm the knockout efficiency. Noninfected and gRNA-control-infected cells were used as controls.
Liu J., Wang T., Creighton C.J., Wu S.P., Ray M., Janardhan K.S., Willson C.J., Cho S.N., Castro P.D., Ittmann M.M., Li J.L., Davis R.J, & DeMayo F.J. (2019). JNK1/2 represses Lkb1-deficiency-induced lung squamous cell carcinoma progression. Nature Communications, 10, 2148.
+ Open protocol
+ Expand
2

CRISPR-Mediated Knockout of MIG-6 and ERBB4

Check if the same lab product or an alternative is used in the 5 most similar protocols
The sequences of gRNA targeting MIG-6 and ERBB4 are “CTCGGTGTGCGCGAGTTACT” and “TTATGAGGATCGATATGCCT”, respectively. These gRNAs were cloned into LentiCRISPRv2 vector [59 (link)] by GenScript (Piscataway, NJ). CRISPR-Lenti non-targeting control plasmid was purchased from MilliporeSigma (Billerica, MA) (CRISPR12-1EA) and its sequences of gRNA is “CGCGATAGCGCGAATATATT”. Lentiviruses were made in the Viral Vector Core Laboratory of NIH/NIEHS and then were used to infect A427 cells for knocking out MIG-6 and ERBB4. The pooled cells infected by gRNA were collected for WB to confirm the knockout efficiency. Non-infected and gRNA-Control-infected cells were used as controls.
Liu J., Cho S.N., Wu S.P., Jin N., Moghaddam S.J., Gilbert J.L., Wistuba I, & DeMayo F.J. (2017). Mig-6 Deficiency Cooperates with Oncogenic Kras to Promote Mouse Lung Tumorigenesis. Lung cancer (Amsterdam, Netherlands), 112, 47-56.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!