To produce hybridoma cell-secreted monoclonal antibodies (mAbs), we used a cell fusion technique according to an established protocol [30 (link),31 (link)]. Mouse myeloma cells (SP2/0 cell; ATCC #CRL 1581) were fused with spleen cells from the donor mice using 50% polyethylene glycol (Sigma Chemical Co.). After incubation with hypoxanthine, aminopterin, and thymidine media (Sigma Chemical Co.), supernatants of hybridoma cell culture were screened by ELISA using the recombinant ZIKV NS1 or E proteins (1 μg/ml) as an antigen. After subcloning with limiting dilutions, selected hybridoma colonies were transferred into 25 cm2 tissue culture flasks (Nunc, Roskilde, Denmark) with RPMI-1640 medium (Gibco/BRL) containing 10% FBS (Gibco/BRL).
Sp2 0 cell
Manufactured by American Type Culture Collection
Sourced in United States
SP2/0 cells are a type of mouse myeloma cell line commonly used in the production of monoclonal antibodies. They are known for their ability to efficiently fuse with B cells to generate hybridomas.
Automatically generated - may contain errors
Lab products found in correlation
Aminopterin, by Merck Group (1 mentions)
25 cm2 tissue culture flask, by Thermo Fisher Scientific (1 mentions)
Hypoxanthine, by Merck Group (1 mentions)
Polyethylene glycol, by Merck Group (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (1 mentions)
Puromycin, by Merck Group (1 mentions)
Hek293t cell, by American Type Culture Collection (1 mentions)
5 protocols using sp2 0 cell
1
Monoclonal Antibody Production from Hybridoma Cells
2
Lentiviral Knockdown of Reelin in Mouse Myeloma Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mouse multiple lymphoma cell line SP2/0 cell was purchased from ATCC (CRL8006). The cells were confirmed not contaminated by mycoplasma. SP2/0 cells were cultured in RPMI-1640 Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin in a 5% CO2/water-saturated incubator at 37 °C. Three lentivirus plasmids containing short hairpin RNA (shRNA) for Reelin (LV3-Reln-542/2565/3490) or the negative control (LV3-NC) were infected into SP2/0 cells. Lentivirus used to knock down Reelin was designed by GenePharma (Shanghai) and the targeted sequences were listed in Table 1 . Stably infected SP2/0 cells were selected and used for establishing animal model.
Targeted sequences of Reelin by lentivirus.
| Name | Sequence (5ʹ to 3ʹ) |
|---|---|
| LV3-NC | TTCTCCGAACGTGTCACGT |
| LV3-Reln-Mus-542 | GCACCTTCTTTGATGGCTTGC |
| LV3-Reln-Mus-2565 | GCAGCTAATCACGTCCTTTCT |
| LV3-Reln-Mus-3490 | GCACTTCCTTCCACGATTATG |
3
Culturing Human Myeloma and Mouse Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human myeloma cell line XG-7 (a kind gift from Professor Xue-guang Zhang of Suzhou University, China), mouse fibrosarcoma L929 cells and SP2/0 cells (purchased from American Type Culture Collection [ATCC], Manassas, VA, USA) were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium supplemented with 10% fetal bovine serum (FBS) and penicillin–streptomycin (50 IU/mL and 50 g/mL, respectively) at 37°C. Moreover, 50 μmol/L 2-mercaptoethanol and 2 ng/mL rhIL-6 were added to the media in XG-7 cells.31 (link),32 (link) The study was approved by the Ethics Review Boards at Beijing Institute of Basic Medical Sciences.
4
Monoclonal Antibody Production Against CEA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
KM mice were i.p. immunized with CEA‐expressing L929 transfectant (1 × 107 cells per head per shot) weekly for 5 weeks. Spleen cells were fused with SP2/0 cells (American Type Culture Collection). Antibody‐secreting hybridomas were initially screened by flow cytometry, as described below, with CEA‐expressing L929 transfectants as positive selection and CEA‐null L929 transfectants as negative selection. Hybridomas were further selected by competitive flow cytometry with CEA‐expressing L929 transfectants and soluble CEA. We selected clone 15‐1‐32 based upon the results of flow cytometry and carried out limiting dilution to isolate a single clone, producing a monoclonal antibody.
5
Stable Expression of BC094916 in Myeloma and HEK Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse myeloma cell line SP 2/0 cells and human embryonic kidney HEK 293T cells were from the American Type Culture Collection (ATCC; Rockville, MD, usa) and described previously [21 (link)]. All cells were maintained in complete RPMI 1640 medium in a humidified 5% CO2 atmosphere at 37 °C. For cell transfection, BC094916 cDNA (General Biosystems, Anhui, China) was cloned into lentiviral vector LV201 or LV122 (Fugene Corp., Guangzhou, China) to generate BC094916 and BC094916-EGFP fusion protein, respectively. BC094916-expressing LV201 or LV122 was then transfected into SP 2/0 cells, and stable transfectants were identified by drug selection (Puromycin, Sigma, 10 μg/ml).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!