454 genome sequencer

Manufactured by Roche

Sourced in United States

The 454 Genome Sequencer is a next-generation DNA sequencing instrument developed by Roche. It utilizes a sequencing-by-synthesis approach to rapidly sequence genetic material. The instrument is designed to generate high-throughput, high-quality sequence data for a variety of genomic applications.

Automatically generated - may contain errors

Lab products found in correlation

Flx titanium reagents, by Roche (2 mentions) Mobio powersoil kit, by Qiagen (2 mentions) Ampure xp bead, by Beckman Coulter (2 mentions) 2100 bioanalyser, by Agilent Technologies (1 mentions) 2100 bioanalyzer, by Agilent Technologies (1 mentions) Ex taq dna polymerase, by Takara Bio (1 mentions) Genome sequencer junior, by Roche (1 mentions)

6 protocols using 454 genome sequencer

Profiling Gut Microbiome by 16S rRNA Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Faecal bacterial DNA was isolated according to procedures described previously⁽¹⁶ ⁾ using the MO BIO PowerSoil™ Kit (MO BIO Laboratories, Carlsbad, CA, USA). Amplification of a 600 bp sequence of the V4–V6 variable region of the 16S rRNA gene was done using barcoded primers as previously described⁽¹⁷ ⁾. PCR amplicons were further purified utilising AMPure XP beads (Beckman-Coulter Inc.). Amplicons were combined in equimolar ratios to create a DNA pool that was used for pyrosequencing. DNA quality of amplicon pools was assessed before pyrosequencing using a 2100 Bioanalyser (Agilent Technologies). Pyrosequencing was performed at the W. M. Keck Center for Biotechnology at the University of Illinois utilising a 454 Genome Sequencer and FLX titanium reagents (Roche Applied Science).

Kerr K.R., Dowd S.E, & Swanson K.S. (2014). Salmonellosis impacts the proportions of faecal microbial populations in domestic cats fed 1–3-d-old chicks. Journal of Nutritional Science, 3, e30.

+ Open protocol

+ Expand

Profiling Gut Bacterial Diversity via 16S rRNA Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Faecal bacterial DNA was isolated according to procedures described previously⁽²⁰ ⁾ using the MO BIO PowerSoil™ Kit (MO BIO Laboratories). Amplification of a 600 bp sequence of the V4–V6 variable regions of the 16S rRNA gene was done using barcoded primers as previously described⁽²¹ ⁾. PCR amplicons were further purified utilising AMPure XP beads (Beckman-Coulter Inc.). Amplicons were combined in equimolar ratios to create a DNA pool that was used for pyrosequencing. DNA quality of amplicon pools was assessed before pyrosequencing using a 2100 Bioanalyzer (Agilent Technologies). Pyrosequencing was performed at the W. M. Keck Center for Biotechnology at the University of Illinois utilising a 454 Genome Sequencer and FLX titanium reagents (Roche Applied Science).

Kerr K.R., Dowd S.E, & Swanson K.S. (2014). Faecal microbiota of domestic cats fed raw whole chicks v. an extruded chicken-based diet. Journal of Nutritional Science, 3, e22.

+ Open protocol

+ Expand

Oyster Microbiome Profiling via 16S rRNA Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Universal 16S primers with 454 adapters 27F (5’ – GCCTTGCCAGCCCGCTCAGTCAGAGTTTGATCCTGGCTCAG – 3’) and 338R (5’ – GCCTCCCTCGCGCCATCAG-barcode-CATGCTGCCTCCCGTAGGAGT – 3’) with 8-mer barcodes on the reverse primer (Hamady et al. 2008 (link)) were used to amplify ~300bp of the 16S rRNA gene from the DNA extractions of three randomly selected oyster EF and two water samples each month. Bacterial DNA (0.5 – 1 ng) was combined with 10X buffer (1X final concentration), dNTPs (0.25 mM each), forward primer mix (0.1 μM final concentration), reverse primer mix (0.1 μM final concentration), and TaKaRa Ex Taq DNA Polymerase (1.25 U) to a final volume of 25 μL. PCR amplification of samples was performed using the following conditions: 95°C for 5 minutes; 30–34 cycles of 95°C for 30 seconds, 52°C for 30 seconds, 72°C for one minute; 72°C for 7 minutes. The entire PCR volume was run on a 1.8% agarose gel. Amplicon bands were excised and DNA purified using the Qiaquick Gel Extraction kit. One hundred nanograms of amplified DNA per sample was used for sequencing. Samples were sequenced on the Roche 454 Genome Sequencer with FLX Titanium technology. Sequences have been submitted to the SRA with BioProject PRJNA450640 and BioSample accessions SAMN08943017 - SAMN08943076.

Sakowski E.G., Wommack K.E, & Polson S.W. (2020). Oyster Calcifying Fluid Harbors Persistent and Dynamic Autochthonous Bacterial Populations That May Aid in Shell Formation. Marine ecology progress series, 653, 57-75.

+ Open protocol

+ Expand

Genome Sequencing and Microsatellite Identification in P. ramosa

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Raw sequence data for the P. ramosa genome was retrieved from the NCBI Sequence Read Archive (http://www.ncbi.nlm.nih.gov/sra). The experiment was reported in [13 (link)]. It consisted in one run of sequencing on one GS Titanium PicoTiterPlate on a 454 Genome Sequencer (Roche Diagnostics, Indianapolis, IN, USA), using the recommended standard protocols and chemistry.
After converting raw sequence data to the fastq format, quality control and filtering was performed using the PRINSEQ web (http://edwards.sdsu.edu/prinseq) [14 (link)]. Briefly, read ends were first trimmed by quality scores, after which only sequences longer than 250 bp, having a mean Phred quality score higher than 35% and less than 1% Ns were retained. Exact sequence duplicates were removed.
Microsatellites were identified by running the QDD pipe-line [15 (link)] using the following criteria: a minimum of eight repeats for dinucleotide motifs, six repeats for trinucleotide motifs and five repeats for tetranucleotide motifs and a minimum length of 100 pb for the PCR product. Primer sequences generated by QDD were checked for end stability, self-complementarity and complementarity between primers in a same pair to avoid the formation of primer dimers.

Le Corre V., Reibel C, & Gibot-Leclerc S. (2014). Development of Microsatellite Markers in the Branched Broomrape Phelipanche ramosa L. (Pomel) and Evidence for Host-Associated Genetic Divergence. International Journal of Molecular Sciences, 15(1), 994-1002.

+ Open protocol

+ Expand

Amplicon Sequencing of Microbial Communities

Check if the same lab product or an alternative is used in the 5 most similar protocols

Pooled DNA samples were sequenced using the Roche/454 Genome sequencer or Genome Sequencer Junior platforms (454, Branford, CT, USA). The sequences obtained were processed using the QIIME software package [48 (link)] using default parameters and the R statistical package [49 ] unless otherwise stated. Briefly, sequences were collapsed into operational taxonomic units (OTUs) at 97% similarity, from which a representative sequence was selected. These representative sequences were used for taxonomic classification, OTU table creation, and UniFrac calculations. Samples yielding less than 300 sequences and OTUs containing only one sequence across all samples were removed from further analysis [50 (link)]. A multiple rarefaction procedure was implemented as follows to increase the confidence that the community assessed was a representative of the actual community present in the sample and to remove biases caused by uneven sampling depth across all samples: after filtering, the remaining samples were rarefied down to 500 sequences 100 times, and an average of the sequence counts for these rarefactions was used. The final OTU table was filtered to contain OTUs which were present in at least ten samples (Additional file 3: Table S2).

Benitez A.J., Hoffmann C., Muir A.B., Dods K.K., Spergel J.M., Bushman F.D, & Wang M.L. (2015). Inflammation-associated microbiota in pediatric eosinophilic esophagitis. Microbiome, 3, 23.

+ Open protocol

+ Expand

NGS of T-cell receptor subunits

Check if the same lab product or an alternative is used in the 5 most similar protocols

Linear amplification and next-generation sequencing (NGS) were performed as previously described [8 (link), 12 (link)], starting from 500 ng of total RNA. NGS was performed on the Roche/454 Genome Sequencer using the Titanium platform. For the TCR α sequencing a set of primers was developed covering all functional TCR α gene variants as described by IMGT [28 (link)]. Primer sequences are available upon request. The protocol for preparation and NGS TCR α was identical to that of the TCR β analysis.

Klarenbeek P.L., Doorenspleet M.E., Esveldt R.E., van Schaik B.D., Lardy N., van Kampen A.H., Tak P.P., Plenge R.M., Baas F., de Bakker P.I, & de Vries N. (2015). Somatic Variation of T-Cell Receptor Genes Strongly Associate with HLA Class Restriction. PLoS ONE, 10(10), e0140815.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!