Superscript 2 reverse transcriptase

RNA was extracted from cultured cells with TRI Reagent (Sigma–Aldrich Corporation, Lyon, France) and reverse transcribed using SuperScript II Reverse Transcriptase (RT) (Invitrogen Life Technologies) following to the manufacturer’s instructions. cDNA was subjected to PCR using PowerUp SYBR Green Master Mix (2X) (ThermoFisher Scientific) to detect IFN-β expression. The primers used for PCR detection as follows: for human IFN-β, forward primer AGCTGAAGCAGTTCCAGAAG and reverse primer AGTCTCATTCCAGCCAGTGC. Primers specific to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (forward primer AGGGCTGCTTTTAACTCTGGT and reverse primer CCCCACTTGATTTTGGAGGGA) was served as the internal control. PCR was carried out in StepOnePlus Real-Time PCR Systems (ThermoFisher Scientific) programmed as follows: 94 °C for 15 s, 63 °C for 10 s, and 72 °C for 15 s for a total of 40 cycles, before melting curve. Results were analyzed by the ΔΔCT method, where CT is threshold cycle, and normalized to GAPDH mRNA. Data are represented as levels of mRNA relative to the mock transfected control samples and are displayed as the means ± SD of results from at least three independent experiments.

Snap‐frozen hearts were homogenised in TRI Reagent® (Sigma‐Aldrich), and 1‐bromo‐3‐chloro‐propane (BCP; Sigma‐Aldrich) then added. The upper aqueous phase, after centrifugation, was mixed with 2 m pH 4 sodium acetate and isopropanol. After centrifugation, the resulting pellet was dissolved in RDD buffer with DNaseI (Qiagen). Phenol : chloroform was added and the supernatant was removed, mixed with chloroform and centrifuged again. The supernatant was removed and mixed with 3 m NaAc pH 5.2 and ethanol. After centrifugation, the resulting pellet was dissolved in DEPC‐treated H₂O. Purity of RNA was checked using NanoDrop 2000 (Thermo Scientific).
The cDNA synthesis was performed according to the SuperScript™ II Reverse Transcriptase (RT) (Invitrogen) protocol. RT‐positive samples had SuperScript II RT added to them, and in RT‐negative samples, SuperScript II RT was replaced with dH₂O.

RNA was extracted from hearts lysates or cultured cells with TRIzol Reagent (Invitrogen, Life Technologies) and reverse transcribed using SuperScript II Reverse Transcriptase (RT) (Invitrogen Life Technologies) following to the manufacturer’s instructions. cDNA was subjected to PCR using PowerUp SYBR Green Master Mix (2X) (ThermoFisher Scientific) to detect IFN-β. The primers used for PCR detection as follows: for mouse IFN-β, forward primer 5’- GCCTTTGCCATCCAAGAGATGC-3’ and reverse primer 5’-ACACTGTCTGCTGGTGGAGTTC-3’. Primers specific to mouse GAPDH (forward primer 5’-CATCACTGCCACCCAGAAGACTG-3’ and reverse primer 5’-ATGCCAGTGAGCTTCCCGTTCAG-3’) were used as the internal control. PCR was carried out in StepOnePlus Real-Time PCR Systems (ThermoFisher Scientific) programmed as follows: denaturation step at 94°C for 15s, annealing step at 63°C for 10s, and extension step at 72°C for 15s (40 cycles) for human primers or denaturation step at 95°C for 15s, annealing/extension step at 65°C for 1min (40 cycles) for mouse primers, before melting curve. Results were analyzed with ΔΔCT method, where CT is threshold cycle, and normalized to GAPDH mRNA. Data are represented as levels of mRNA relative to that of the mock transfected control samples and are displayed as the means ± SD of results from at least three independent in vitro experiments.

RNA was extracted from cells using an RNeasy Micro Kit (Qiagen) according to the manufacturer's instructions and converted to cDNA using Superscript II reverse-transcriptase (RT) (Invitrogen), with dNTPs and random hexamers. PCR was carried out using primers specific to NPM–ALK24 (link), RAG2 or Vα2 (OTI transgene) (OT1 FWD 5′- ACGTGTATTCCCATCTCTGG -3′, OTI R 5′- CTGTTCATAATTGGCCCGA -3′; NPM–ALK FWD 5′- TCCCTTGGGGGCTTTGAAATA -3′, NPM–ALK RVS 5′- CGAGGTGCGGAGCTTGCTCAG -3′; RAG A 5′- GGGAGGACACTCACTTGCCAGTA -3′, RAG B 5′- AGTCAGGAGTCTCCATCTCACTGA -3′ and NeoA 5′- CGGCCGGAGAACCTGCGTGCAA -3′).

Total RNA from cultured cells was extracted with RNeasy spin columns (Qiagen) or the SV Total RNA Isolation System (Promega) according to manufacturer's instructions. One μg of total RNA was reverse transcribed using oligo (dT) primers and Superscript II Reverse Transcriptase (RT) (Invitrogen, Life Technologies) following manufacturer's instructions. Conventional PCR was performed using PCR master mix (Promega). qPCR was performed using TaqMan gene expression assays (Life Technologies) according to the manufacturer's instructions. Validated TaqMan probes were selected to target specific genes as follows: SAFB1 (Hs01561652_gl), SAFB2 (Hs01006796_g1), ITGB4 (Hs00236216_m1), SHF (Hs00403125_m1), MALAT-1 (Hs00273907_s1), and β-actin (Hs99999903_m1). Data analysis was performed using the comparative C_t method normalised against β-actin expression. Experiments were performed in triplicate and statistical analysis was performed using Student's t-test or Repeated Measures ANOVA with Dunnett's Multiple Comparison Test. All effects at P < 0.05 are reported as significant.