Applied biosystems quantstudio 3

Manufactured by Thermo Fisher Scientific

Sourced in United States, Japan, China

The Applied Biosystems QuantStudio 3 is a real-time PCR system designed for use in life science research laboratories. It is capable of performing quantitative and qualitative analysis of nucleic acid samples.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

QuantStudio 3 (1144 citations) Applied Biosystems QuantStudio 3 Real-Time PCR System (52 citations) Applied Biosystems (14 citations) Applied Biosystems QuantStudio 3 system (7 citations) Applied Biosystems™ QuantStudio™ 3 instrument (5 citations) Applied Biosystems QuantStudio 3 real-time PCR machine (3 citations) Applied Biosystems QuantStudio 3&5 (2 citations)

38 protocols using applied biosystems quantstudio 3

Viral Copy Number and mRNA Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the quantification of viral copy number, total RNA was isolated from cell supernatants using the QIAamp viral RNA mini kit (Qiagen, Hilden, Germany) and cDNA was synthesized from 1 μg of total RNA using SuperScript IV (Invitrogen, Waltham, MA, USA) according to the manufacturer’s protocol. qRT-PCR was performed using Power SYBR Green PCR master mix (Applied Biosystems, Foster City, CA, USA) and an Applied Biosystems QuantStudio3 (Applied Biosystems) following the manufacturer’s protocol.
For measurement of viral mRNA, total RNA was isolated using TRIzol (Ambion, Leicestershire, UK) reagent. Subsequently, cDNA was synthesized from 1 μg of total RNA using a SuperScript IV (Invitrogen). qRT-PCR was performed using Power SYBR Green PCR master mix (Applied Biosystems) and Applied Biosystems QuantStudio3 (Applied Biosystems) as follows: denaturation at 95 ℃ for 5 min, followed by 40 cycles of 95 ℃ for 30 s and 60 ℃ for 30 s. The sequences of the GAPDH primers used were: 5′-GAA CGG GAA GCT TGT CAT CAA TGG-3′ and 5′-TGT GGT CAT GAG TCC TTC CAC GAT-3′. The sequences of the N primers used were: 5′-GGG AGC CTT GAA TAC ACC AAA A-3′ and 5′-TGT AGC ACG ATT GCA GCA TTG-3′⁴⁶.

Cho J., Lee Y.J., Kim J.H., Kim S.I., Kim S.S., Choi B.S, & Choi J.H. (2020). Antiviral activity of digoxin and ouabain against SARS-CoV-2 infection and its implication for COVID-19. Scientific Reports, 10, 16200.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of ACE2 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RT-qPCR was performed using a Luna universal one-step RT-qPCR kit (number E3005L; New England Biolabs) on RNA extracted from naive NRGL-LX and HNFL-LX. RT-qPCR protocol was performed using the manufacturer’s protocol with minor modifications. Briefly, 12 μL of reaction mixture containing 2 μL of RNA, 2 uL of each forward and reverse primer (10 uM), 0.6 μL of the 20X Luna WarmStart RT enzyme mix, and 6 μL of the 2X Luna universal one-step reaction mix was subjected to one-step RT-qPCR protocol using Applied Biosystems QuantStudio 3 (ThermoFisher Scientific), with the following cycling conditions: reverse transcription at 50°C for 10 min, initial denaturation at 95°C for 2 min followed by 40 cycles of denaturation at 95°C for 15 s and annealing/extension at 60°C for 1 min, ending with melt curve analysis from 65°C to 95°C, rising in 0.5°C/s increments, waiting for 30 s at 65°C and for 5 s at each step thereafter, and acquiring fluorescence at each temperature increment. The threshold cycle (C_q) values were determined using the QuantStudio Design and Analysis software V1.5.1. Human RPS11 was used as a reference gene and the human ACE2 C_q values were normalized to human RPS11.

Kenney D.J., O’Connell A.K., Turcinovic J., Montanaro P., Hekman R.M., Tamura T., Berneshawi A.R., Cafiero T.R., Al Abdullatif S., Blum B., Goldstein S.I., Heller B.L., Gertje H.P., Bullitt E., Trachtenberg A.J., Chavez E., Nono E.T., Morrison C., Tseng A.E., Sheikh A., Kurnick S., Grosz K., Bosmann M., Ericsson M., Huber B.R., Saeed M., Balazs A.B., Francis K.P., Klose A., Paragas N., Campbell J.D., Connor J.H., Emili A., Crossland N.A., Ploss A, & Douam F. (2022). Humanized mice reveal a macrophage-enriched gene signature defining human lung tissue protection during SARS-CoV-2 infection. Cell Reports, 39(3), 110714.

+ Open protocol

+ Expand

Ovarian Tissue mRNA Extraction and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total mRNA was extracted from ovarian tissues with Trizol reagent according to the manufacturer’s procedure. RNA (2 μg) was reversely transcribed into cDNA by using TransScript^® One-Step gDNA Removal and cDNA Synthesis SuperMix Kit. RT-qPCR was performed in 10 μl volume using 2 × Universal SYBR Green Fast qPCR Mix kit and Applied Biosystems QuantStudio 3 (Thermo Fisher Scientific). Gapdh was used as the reference and gene expression levels were calculated using the 2^-ΔΔCt method. The mRNA expression levels were calculated as relative expression to Gapdh. All the primers were summarized in Table 1, and the Ct values were summarized in Supplemental Table S3.

Huang L., Liang A., Li T., Lei X., Chen X., Liao B., Tang J., Cao X., Chen G., Chen F., Wang Y., Hu L., He W, & Li M. (2022). Mogroside V Improves Follicular Development and Ovulation in Young-Adult PCOS Rats Induced by Letrozole and High-Fat Diet Through Promoting Glycolysis. Frontiers in Endocrinology, 13, 838204.

+ Open protocol

+ Expand

RPA-Cas12a for Rapid Molecular Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

RPA was performed using the TwistAmp^™ Basic kit (TwistDx, Cambridge, UK). Briefly, 12.5 μL of the total reaction volume contained the following: 1 × rehydration buffer, 480 nmol L⁻¹ of both forward and reverse primers, 2 μL diethylpyrocarbonate water, 2.5 μL of the DNA template and 1 μL of magnesium acetate (MgOAc; final concentration: 14 mmol L⁻¹). The reaction tubes were incubated at 37 °C for 15 min, including a manual mixing step (5-s tube vortex) in the fourth minute. For the no-template control (NTC), these reactions were prepared by substituting the DNA template with an equal volume of molecular grade water.
After RPA, 12.5 μL of RPA products were mixed with 7.5 μL of Cas12a reaction mixture, which contained 100 nmol L⁻¹ of crRNA, 50 nmol L⁻¹ of ssDNA reporter, 50 nmol L⁻¹ of LbaCas12a (EnGen LbaCas12a, M0653T, NEB), 1 × NEBuffer 2.0 (New England Biolabs, UK), and 1.5 μL of RNase-free water, for a final volume of 20 μL. Then, the reaction was incubated at 37 °C using the Applied Biosystems ^™ Quant Studio 3 (Thermo Fisher Scientific, USA) and fluorescence was measured every minute.

Yu D., Liang B., Xu H., Chen L., Ye Z., Wu Z, & Wang X. (2023). CRISPR/Cas12a-based assay for the rapid and high-sensitivity detection of Streptococcus agalactiae colonization in pregnant women with premature rupture of membrane. Annals of Clinical Microbiology and Antimicrobials, 22, 8.

+ Open protocol

+ Expand

Quantitative RT-PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The cDNA was synthesized with total RNA using SYBR Green qPCR (TAKARA, Tokyo, Japan) according to the manufacturer’s protocol. Real-time PCR was conducted with SYBR Premix Ex Taq II (TAKARA, Tokyo, Japan) in an Applied Biosystems QuantStudio 3 (Thermo Fisher Scientific) using transcript-specific primers (Table S1). Relative quantification analysis was conducted using a relative standard curve for threshold values (CT). qRT-PCR data were standardized with OsACTIN1 as an internal reference. Mapping and calculating correlation coefficients for RNA-Seq and qRT-PCR data were done using the Origin (version 9, Northampton, MA, USA) mapping software.

Xin W., Zhang L., Zhang W., Gao J., Yi J., Zhen X., Li Z., Zhao Y., Peng C, & Zhao C. (2019). An Integrated Analysis of the Rice Transcriptome and Metabolome Reveals Differential Regulation of Carbon and Nitrogen Metabolism in Response to Nitrogen Availability. International Journal of Molecular Sciences, 20(9), 2349.

+ Open protocol

+ Expand

Quantifying Gene Expression in Ovarian Tissues

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from ovary tissues or KGN cells was extracted using the TRIzol reagent (15596018; Thermo Fisher Scientific, USA). The synthesis of cDNA was performed with the TransScript^® One-Step gDNA Removal and cDNA Synthesis SuperMix Kit (AT311-02; TransGen Biotech, China), according to the manufacturer's protocol. Real-time PCR analyses were performed with ChamQ Universal SYBR qPCR Master Mix (Q711-02; Vazyme, China) and Applied Biosystems QuantStudio 3 (Thermo Fisher Scientific, USA). GAPDH was used as the reference, and gene expression levels were calculated using the comparative Ct method (27 (link)). The primer sequences used for amplification are shown in Table 1.

Liang A., Zhang W., Wang Q., Huang L., Zhang J., Ma D., Liu K., Li S., Chen X., Li S, & Lei X. (2023). Resveratrol regulates insulin resistance to improve the glycolytic pathway by activating SIRT2 in PCOS granulosa cells. Frontiers in Nutrition, 9, 1019562.

+ Open protocol

+ Expand

Quantitative Detection of SARS-CoV-2 RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

To determine SARS-CoV-2 RNA copies, RT-qPCR for SARS-CoV-2 E protein was performed using a One-Step Taqman-based system. Briefly, a 20 μL reaction mixture containing 10 μL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047–082), 0.5 μM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT), 0.5 μM Primer E_Sarbeco_R2 (ATATTGCAGCAGTACGCACACA), 0.25 μM Probe E_Sarbeco_P1 (FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1), and 2 μL of total RNA was subjected to One-Step RT-qPCR using Applied Biosystems QuantStudio 3 (ThermoFisher Scientific), with the following cycling conditions; reverse transcription for 10 min at 55°C and denaturation at 94°C for 3 min followed by 45 cycles of denaturation at 94°C for 15 s and annealing/extension at 58°C for 30 s. Ct values were determined using QuantStudio™ Design and Analysis software V1.5.1. Calculations for RNA copies/mL were determined using a SARS-CoV-2 E RNA as a standard.

+ Open protocol

+ Expand

Rice Leaf Transcriptome Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Three samples of rice first leaf were examined after low-N and control-N treatment for 60; three biological replicates per sample were used for qRT-PCR analyses. The first strand cDNA was synthesized using the Prime Script RT Master Mix (Takara). Real-time PCR was performed with SYBR Premix Ex Taq II (Takara) according to the manufacturer’s protocol in Applied Biosystems QuantStudio 3 (Thermo Fisher Scientific, Germany); transcript specific primers are listed in Table S1. Relative quantification analysis was performed with a relative standard curve for threshold values (CT). qRT-PCR data was standardized using OsACTIN1 as an internal reference.

Xie S., Liu H., Ma T., Shen S., Zheng H., Yang L., Liu L., Wei Z., Xin W., Zou D, & Wang J. (2023). Global Phosphoproteomic Analysis Reveals the Defense and Response Mechanisms of Japonica Rice under Low Nitrogen Stress. International Journal of Molecular Sciences, 24(9), 7699.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Leishmania Parasites

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative PCR (qPCR) was performed using primers to Leishmania kDNA minicircle to determine parasite load. The primer sequences were as follows: 5’-GGC CCA CTA TAT TAC ACC AAC CCC-3’ and 5’-GGG GTA GGG GCG TTC TGC GAA-3’. The reactions were performed in a final volume of 20 µL, consisting of 1x Universal SYBR Green PCR master mix (Applied Biosystems, USA), 0.2 µM of each primer and 50 ng of genomic DNA. The reaction conditions were 94°C for 12 minutes, followed by 40 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 30 s. The melting curve was processed with 95°C for 5 s, followed by 50°C for 15 s and 95°C for 5 s. All qPCR assays included positive (L. braziliensis DNA) (MHOM/BR/2000/LTCP13396) and negative controls (blank and non-infected HEK cell DNA). To determine the number of parasites, a standard curve was built using serial dilution of L. braziliensis DNA (5 x 10² to 5 x 10^-3 ng/µL). The reactions were carried out in an Applied Biosystems™ QuantStudio 3 (Thermo Fischer Scientific, USA). The parasite load was calculated as equivalent parasites per 50 ng of DNA.

de Carvalho B.C., Vital T., Osiro J., Gomes C.M., Noronha E., Dallago B., Rosa A.D., Carvalho J.L., Hagström L., Hecht M, & Nitz N. (2022). Multiparametric analysis of host and parasite elements in new world tegumentary leishmaniasis. Frontiers in Cellular and Infection Microbiology, 12, 956112.

+ Open protocol

+ Expand

Comprehensive RNA Isolation and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the isolation and purification of both cytoplasmic and nuclear RNA from MIC cells, the Cytoplasmic & Nuclear RNA Purification Kit has been used according to the manufacturer’s instructions (Norgen Biotek). Total RNA was isolated with TRIzol Reagent (Invitrogen) and the cDNA was synthesized using the FastQuant RT Kit (Tiangen) which includes DNase treatment of RNA to eliminate genomic contamination. The expression patterns of each gene were performed by using SYBR Premix Ex Taq (Takara). The small RNA was extracted by using miRcute miRNA Isolation Kit (Tiangen), and miRcute miRNA FirstStrand cDNA Synthesis Kit (Tiangen) was applied to reverse transcription of miRNAs. The expression analysis of miR-15a-5p was executed by using the miRcute miRNA qPCR Detection Kit (Tiangen). Real-time PCR was performed in an Applied Biosystems QuantStudio 3 (Thermo Fisher Scientific). GAPDH and 5.8S rRNA were employed as endogenous controls for mRNA and miRNA, respectively. Primer sequences are displayed in S1 Table.

Zheng W., Chu Q., Yang L., Sun L, & Xu T. (2021). Circular RNA circDtx1 regulates IRF3-mediated antiviral immune responses through suppression of miR-15a-5p-dependent TRIF downregulation in teleost fish. PLoS Pathogens, 17(3), e1009438.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!