mRNA expression analysis: Total RNA was isolated from mouse left ventricular tissue using the RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. cDNA was then prepared by using the Omniscript RT Kit (Qiagen, USA). qRT-PCR was performed using SYBR Green (miScript SYBR Green PCR Kit, Qiagen, USA) and the Mx3000p Real-time PCR system (Agilent). The expression of the target genes was normalized to GAPDH gene expression levels. miRNA expression analysis: miRNA was extracted from left ventricular tissue and HL-1 cells using the miRNeasy Mini Kit (Qiagen, USA) and then reverse-transcribed with the miScript II RT Kit (Qiagen, USA) using miScript HiSpec buffer. qRT-PCR was performed using SYBR Green (miScript SYBR Green PCR Kit, Qiagen, USA) and the Mx3000p Real-time PCR system (Agilent). U6 was used as the reference gene. Each sample was processed in triplicate. All data were analyzed for relative expression using the 2−ΔΔCt method. The primers used in our experiments are provided in Supplementary Table 1 .
Miscript sybr green pcr kit
Manufactured by Qiagen
Sourced in Germany, United States, China, Canada, Switzerland, United Kingdom, Spain, Netherlands, France, Japan, Italy
The MiScript SYBR Green PCR Kit is a laboratory product designed for real-time PCR analysis. It provides the necessary reagents to perform quantitative reverse transcription PCR (RT-qPCR) experiments, including the SYBR Green I dye for detection of amplified DNA.
Automatically generated - may contain errors
Lab products found in correlation
Miscript 2 rt kit, by Qiagen (690 mentions)
Trizol reagent, by Thermo Fisher Scientific (318 mentions)
Miscript reverse transcription kit, by Qiagen (264 mentions)
Mirneasy mini kit, by Qiagen (234 mentions)
Miscript primer assay, by Qiagen (180 mentions)
Trizol, by Thermo Fisher Scientific (128 mentions)
Primescript rt reagent kit, by Takara Bio (81 mentions)
Mirneasy serum plasma kit, by Qiagen (55 mentions)
Rneasy mini kit, by Qiagen (50 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (45 mentions)
Lightcycler 480, by Roche (41 mentions)
Miscript 2 reverse transcription kit, by Qiagen (40 mentions)
Mirneasy kit, by Qiagen (35 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (34 mentions)
Applied biosystems 7500 real time pcr system, by Thermo Fisher Scientific (31 mentions)
Mirvana mirna isolation kit, by Thermo Fisher Scientific (28 mentions)
Miscript universal primer, by Qiagen (27 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (27 mentions)
Lightcycler 480 real time pcr system, by Roche (27 mentions)
Sybr premix ex taq 2, by Takara Bio (26 mentions)
1 547 protocols using miscript sybr green pcr kit
1
Comprehensive mRNA and miRNA Expression Analysis
2
Quantifying Mature and Primary miRNA Expression
3
Quantification of miRNA and mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The miScript Primer Assay, miScript Precursor Assay, and miScript SYBR Green PCR Kits (Qiagen) were used to quantify mature miRNAs (miR-15a, 16, 21, 31, 92a-1, 146a, and 155) and precursor miRNAs (miR-31 and 16) following the manufacturer’s instructions. RNU6 was used as a normalization control. Target mRNA expression levels were estimated using the miScript SYBR Green PCR Kit (Qiagen) following the manufacturer’s instructions. Detailed qRT-PCR procedures were performed as previously described [29 (link)]. Gene expression levels were normalized against those of GAPDH. The following primer sequences were used to amplify target mRNAs: PPP2R2A (sense 5′-TCGGATGTAAAATTCAGCCA-3′ , antisense 5′-GATGCACCTGGTATGTTTCC-3′ ), STK40 (sense 5′-CAGCACTACGTCATCAAGGAG-3′ , antisense 5′-CGATGTGTCCTCTTGTTGAGC-3′ ), E2F2 (sense 5′-CGTCCCTGAGTTCCCAACC-3′ , antisense 5′-GCGAAGTGTCATACCGAGTCTT-3′ ), and GAPDH (sense 5′-AATGGTGAAGGTCGGTGTGAAC-3′ , antisense 5′-GAAGATGGTGATGGGCTTCC-3′ ). All qRT-PCRs were performed in triplicate using the CFX Connect™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA).
4
Quantifying miRNA and mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from PASMCs using the miRNeasy Mini Kit (Qiagen, Hilden, Germany) and quantified using a NanoDrop spectrophotometer (Thermo Scientific, Waltham, MA, USA). For mature miRNA detection, template RNA (2 μg) was reverse transcribed to cDNA using the miScript II RT Kit with miScript Hispec buffer (Qiagen) followed by real-time PCR using the miScript SYBR Green PCR Kit (Qiagen) with the manufacturer-provided miScript Universal primer. For mRNA expression analysis, template RNA (500 ng) was reversely transcribed to cDNA using the same kit with miScript Hiflex Buffer followed by real-time PCR using miScript SYBR Green PCR Kit (Qiagen) with QuantiTect primer. The results were normalized to U6 for mature miRNAs and to β-actin for myocardin. Data analysis was performed using the comparative Ct method. Myocardin primers were as follows: forward, 5′-GAGAGCACAATTGCACACCAT-3′; reverse, 5′-CTCTGAGACTCGGGCAATC-3′. β-actin primers were as follows: forward, 5′-CATCCGTAAAGACCTCTATGCCAAC-3′; reverse, 5′-ATGGAGCCACCGATCCACA-3′.
5
Quantitative Analysis of Zebrafish miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time PCR (qRT-PCR) assays (miScript Reverse Transcription Kit and miScript SYBR Green PCR Kit, Qiagen) were performed to determine the expression levels of four known miRNAs (dre-miR-456, dre-miR-22a, dre-miR-206 and dre-miR-192). 10 ng of total RNA extracted from zebrafish embryos was used for cDNA synthesis. U6 snRNA was used as an endogenous control and each reverse transcription was conducted in triplicate. The expression levels of miRNAs were measured by the threshold cycle values (Ct). The relative expression levels were assigned as Equation 2-∆∆ct. The primers were designed as follows (Universal reverse primer was brought in miScript SYBR Green PCR Kit of Qiagen):
dre-miR-456_F: 5′-CAGGCTGGTTAGATGGTTGTCA-3′
dre-miR-22a_F: 5′-GCTGCCAGCTGAAGAACTGTAAA-3′
dre-miR-206_F: 5′-TGGAATGTAAGGAAGTGTGTGGA-3′
dre-miR-192_F: 5′-GTGATGACCTATGAATTGACAGCC-3′
U6 snRNA_F: 5′-CTCGCTTCGGCAGCACA-3′
dre-miR-456_F: 5′-CAGGCTGGTTAGATGGTTGTCA-3′
dre-miR-22a_F: 5′-GCTGCCAGCTGAAGAACTGTAAA-3′
dre-miR-206_F: 5′-TGGAATGTAAGGAAGTGTGTGGA-3′
dre-miR-192_F: 5′-GTGATGACCTATGAATTGACAGCC-3′
U6 snRNA_F: 5′-CTCGCTTCGGCAGCACA-3′
6
Quantitative Analysis of miRNA and mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
miRNA was isolated from tissues or cells using miRcute miRNA Kit (Tiangen, China) according to the manufacturer’s instructions. MiScript II RT kit (Qiagen, Germany) was used for reverse transcription of miRNA. The expression of miR-150 was determined by miScript SYBR Green PCR Kit (Qiagen), using real-time PCR. The primers for miR-150 and U6 were purchased from Qiagen. Ct value of miR-150 was normalized to the U6 and the relative expression was carried out by 2−ΔΔCt method. Total RNA was isolated from C-33A cells using RNAprep pure Micro Kit (Tiangen) and reverse transcription of mRNA was performed using QuantScript RT kit (Tiangen) according to the manufacturer’s protocol. RT-PCR was performed with miScript SYBR Green PCR Kit (Qiagen) and specific primers using the ABI 7900TH Real-Time PCR System (Applied Biosystems, USA). The specific primer sequences for the genes were shown in Table 1 . Relative mRNA expression was carried out using 2−ΔΔCt method after normalization to GAPDH.
Primer sequences used for RT-PCR
| Gene | Primer (forward) 5′–3′ | Primer (reverse) 5′–3 |
|---|---|---|
| GAPDH | CGCTCTCTGCTCCTCCTGTT | CCATGGTGTCTGAGCGATGT |
| CyclinD1 | CAATGACCCCGCACGATTTC | CATGGAGGGCGGATTGGAA |
| p27 | AACGTGCGAGTGTCTAACGG | CCCTCTAGGGGTTTGTGATTCT |
| FASL | CTCCGAGAGTCTACCAGCCA | TGGACTTGCCTGTTAAATGGG |
| BIM | TAAGTTCTGAGTGTGACCGAGA | GCTCTGTCTGTAGGGAGGTAGG |
7
Quantification of miR-9-5p, NEAT1, and SLC26A2 expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA in cells was extracted by TRIzol reagent (Invitrogen), and reversely transcribed into cDNA via High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). qRT-PCR was conducted by a miScript SYBR Green PCR Kit (Qiagen, Hilden, Germany) on the 7900 H T Fast Real-Time PCR system (Applied Biosystems). For miR-9-5p, reverse transcription was conducted by miScript II Reverse Transcription Kit (Qiagen), and the miScript SYBR Green PCR Kit with miScript Primer Assay Kit (Qiagen) was used to detect the miR-9-5p expression. MiR-9-5p, NEAT1, and SLC26A2 mRNA levels were calculated by the 2−ΔΔCt method, and GAPDH served as the endogenous control of NEAT1 and SLC26A2, and U6 for miR-9-5p. The primer sequences used were as follows:
MiR-9-5p: 5′-GCG TCT TTG GTT ATC TAG CTG TA-3′(forward), 5′-AGT GCA GGG TCC GAG GTA TT-3′(reverse); NEAT1: 5′-TGG CTA GCT CAG GGC TTC AG-3′(forward), 5′-TCT CCT TGC CAA GCT TCC TTC-3′(reverse); SLC26A2: 5′-CCA GAT GTG GAG GAT TAG CAG AAT GG-3′(forward), 5′-ACA GCT TCA TAA TCT CTG CGA ACT TCT TTC AGT GT-3′(reverse); U6: 5′-GCT TCG GCA GCA CAT ATA CTA AAA T-3′(forward), 5′-CGC TTC ACG AAT TTG CGT GTC AT-3′(reverse); GAPDH: 5′-CAT GGC CTT CCG TGT CCC CA-3′(forward), 5′-TGC TTC ACC ACC TTC TTG ATG-3′(reverse).
MiR-9-5p: 5′-GCG TCT TTG GTT ATC TAG CTG TA-3′(forward), 5′-AGT GCA GGG TCC GAG GTA TT-3′(reverse); NEAT1: 5′-TGG CTA GCT CAG GGC TTC AG-3′(forward), 5′-TCT CCT TGC CAA GCT TCC TTC-3′(reverse); SLC26A2: 5′-CCA GAT GTG GAG GAT TAG CAG AAT GG-3′(forward), 5′-ACA GCT TCA TAA TCT CTG CGA ACT TCT TTC AGT GT-3′(reverse); U6: 5′-GCT TCG GCA GCA CAT ATA CTA AAA T-3′(forward), 5′-CGC TTC ACG AAT TTG CGT GTC AT-3′(reverse); GAPDH: 5′-CAT GGC CTT CCG TGT CCC CA-3′(forward), 5′-TGC TTC ACC ACC TTC TTG ATG-3′(reverse).
8
Quantitative Analysis of Small RNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared from cells with Sepasol-RNA I Super G (Nakarai Tesque, Inc., Kyoto, Japan) and reverse-transcribed with the miScript II RT Kit (Qiagen, Hilden, Germany) to synthesize complementary DNA of sRNAs. The sRNAs were polyadenylated by poly(A) polymerase, then, bound by oligo-dT primer that have a 5′ universal tag sequence and 3′ degenerate anchor and reverse-transcribed by miScript Reverse Transcriptase. The cDNA with the universal tag was amplified by its complementary sequence and the gene-specific forward primers. Real-time polymerase chain reaction (PCR) was performed using the StepOne software and miScript SYBR Green PCR Kit (QIAGEN). Each of 2×SYBR Master Mix 5 µl, RNase-free water 2 µl, 5 µM target primer 1 µl and 1 µl of 10× universal primer mixture were added to 1 µl of water-soluble sample of cDNA. The reaction was run at 95°C for 10 min, followed by 40 cycles at 95°C for 15 s and 60°C for 1 min. miR-21, miR-155, RNU6 and candidate sRNAs were detected by quantitative PCR (qPCR) using the miScript SYBR Green PCR Kit (Qiagen). Sequences of specific primers were described in Supplementary Table S1 .
9
Mature miRNA Profiling in Heart Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mature miRs were analyzed by miScript II RT kit (Qiagen) and miScript SYBR Green PCR kit with miScript Primer Assay kit (Qiagen) according to manufacturer’s instructions. Briefly, RNA was isolated from left ventricles and cDNA for mature miR profiling was prepared using the miScript II RT kit. Mature miRa were determined by real-time PCR using the miScript SYBR Green PCR kit (Qiagen). cDNA template was diluted to 1 ng/μl in RNase free water. Two nanograms of template cDNA were used for miRs quantification in a final volume of 25 μl system containing specific primers and QuantiTect SYBR Green PCR master mix following manufacturer’s instructions. Primers included miScript Universal Primer, rat-specific miScript mature miRNA primers and SNORD61 miScript Primer Assay (Qiagen). Serial dilutions of the positive control were done on each plate to create a standard curve for the quantification. The real-time PCR was performed in triplicate and threshold cycle numbers were averaged for each sample using IQ5 real-time PCR (BioRad). The expression levels of each mature miR in control and losartan-treated heart tissues were computed following the method described by Livak and Schmittgen,[27 (link)] and expressed as fold of SNORD61.
10
miRNA Expression Profiling in Clinical Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the clinical tissue samples by using the TRIzol reagent (Invitrogen Life Technologies) according to the manufacturer's instructions. Reverse transcription of the extracted RNA was performed using the miScript II RT kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer's instructions. PCR reactions were performed by using the miScript SYBR® green PCR kit (Qiagen GmbH) according to the manufacturer's instructions using the Lightcycler 480 Real-Time PCR System (Roche Diagnostics, Basel, Switzerland). The reaction mixture contained: 2 µl cDNA template, 2µl specific microRNA primer, 2µl 10X miScript Universal Primer, 10µl 2X QuantiTect SYBR Green PCR Master Mix and RNase-free water was added to 20 µl in total. The amplification conditions were as follows: 95°C for 15 mins, followed by 94°C for 15 sec, 55°C for 30 sec and 70°C for 30 sec, for 45 cycles. The 2−ΔΔCT method was used to quantify the relative miRNA expression (30 (link)). U6 was used as an internal control for the normalization and the forward primer was 5′-ACGCAAATTCGTGAAGCGTT-3′ (Invitrogen Life Technologies). The forward primer for miR-205 amplification was 5′-TCCTTCATTCCACCGGAGTCTG-3′ (Invitrogen Life Technologies), and the reverse primer of U6 and miR-205 was the universal primer provided in the miScript SYBR® green PCR kit (Qiagen GmbH).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!