Primescripttm 1st strand cdna synthesis kit

Tranilast was purchased from Sigma-Aldrich, (Mo, USA) and dissolved in dimethyl sulfoxide (DMSO) such thatthe final DMSO concentration in experimental wells did not exceed 0.5% (v/v). Dulbecco’s modified Eagle’s medium and Ham's F12 (DMEM/F12), fetal bovine serum (FBS), trypsin, and acridine orange (AO) were purchased from Sigma-Aldrich Chemical Co (St. Louis, MO, USA). Gene Matrix Universal RNA Purification Kit was purchased from EURx Ltd. Gdansk (Poland ul). PrimeScriptTM 1st strand cDNA Synthesis Kit and SYBR Premix Ex Taq technology were purchased from Takara (Bio Inc. Japan).

Total ribonucleic acid (RNA) was extracted from SH-SY5Y cells using the Easy-spin™ Total RNA Extraction kit (iNtRON Biotechnology, Seoul, Korea). The cDNA synthesis was carried out following the instructions of TaKaRa Prime Script TM 1st strand cDNA synthesis kit (TaKaRa Bio, Tokyo, Japan). For qRT-PCR, 1 μL of gene primers with SYBR Green (Bio-Rad Laboratories, Hercules, CA, USA) in 20 μL of reaction volume was applied. The primers were: SIRT1 forward, 5′TGCTCGCCTTGCTGTAGACTTC3′, reverse, 5′GGCTATGAATTTGTGACAGAGAGATGG3′; β-actin (as an internal control): forward, 5′GCAAGCAGGAGTATGACGAG3′, reverse, 5′CAAATAAAGCCATGCCAATC3′. All reactions with iTaq SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA) were performed on the CFX96 real-time PCR detection system (Bio-Rad Laboratories, Hercules, CA, USA).

Total RNA was diluted to 1 µg as a template, and cDNA was synthesized using a PrimeScript^TM 1st Strand cDNA Synthesis kit (Takara, Kyoto, Japan). The dNTP mixture and the Oligo dT primer were added to the diluted total RNA, and the mixture was left to react at 65 °C for 5 min. The temperature was lowered to 4 °C, and 5× PrimeScript Buffer, RNase inhibitor, and PrimeScript RTase were added to the reaction mixture, which was left to react at 42 °C for 60 min, and RTase activity was stopped at 95 °C for 5 min. DNase-free dH₂O (180 µL) was added to dilute the mixture to 100 ng µL⁻¹.

Total RNA of all collected samples was extracted using the EASYspin Plus Total RNA Extraction Kit (Aidlab, Beijing, China) according to the manufacturer protocol. The NanoDrop 2000 Spectrophotometer was used to determine the quantity and quality of RNAs. Subsequently, using the PrimeScript^TM 1st Strand cDNA Synthesis Kit (TakaRa, Dalian, China) to synthesize first-strand cDNAs. The specific primers were designed according to CDSs (Supplementary Table S3). All melting curves produced by qRT-PCR were shown in Supplementary Fig. S3.
The amplification reactions of qRT-PCR were performed with Lightcycler 96 system (Roche) using SYBR the premix Ex taq (TakaRa) in 20 μL volume with following parameters: initializing denaturation at 95 °C for 30 seconds, following 45 cycles denaturation at 95 °C for 10 seconds; annealing at 53–54 °C for 10 seconds, and extension at 72 °C for 20 seconds. In addition, the default setting for the melting curve stag was chosen. Three biological replicates were maintained for each collected sample. The relative expression levels were calculated according to the 2^−ΔΔCt method47 (link). The heatmap for expression profiles were generated with the Mev 4.0 software48 with Pearson correction and complete linkage clustering.

Total RNAs were extracted with TRIzol reagent (Invitrogen, Burlington, ON, Canada) according to the manufacturer’s instructions. Afterward, 1 μg of DNase-treated RNA was reverse-transcribed using a PrimeScript^TM 1st Strand cDNA synthesis kit (Takara) according to the manufacturer’s protocol. The qPCR analysis was conducted with FastStart Universal SYBR Green Master (Roche), and reactions were performed in an ABI 7900HT (Applied Biosystems) at 95°C for 10 min, followed by 40 cycles at 95°C for 15 s and 58°C for 30 s. The internal controls were Tubulin and Actin2 for Arabidopsis and rice, respectively. Each sample was analyzed in triplicate and relative amounts of mRNA were calculated per the comparative threshold cycle method.
For semi-quantitative RT-PCR, two-step RT-PCR method was chosen. Total RNA extractions and cDNA synthesis were performed as described above. All PCR amplifications were conducted in a total volume of 20 μL under the following conditions: 22–27 cycles of denaturation (94°C, 30 s), annealing (58°C, 35 s), and extension (72°C, 30 s). The primer pairs for semi-quantitative RT-PCR and qPCR are listed in Supplementary Table S1.

First-strand cDNA was generated from total RNA of T. gondii using a PrimeScript^TM 1st Strand cDNA Synthesis Kit (TaKaRa). cDNAs from specific ROP KOs and wild type (WT) RH strain were tested by RT-PCR to amplify a small fragment around the insertion site in each targeted gene using specific primers listed in the Supplemental Material (Table S1).

RNA purification was completed according to the instructions of the manufactured kit (RNeasy^® Plus Mini kit; Qiagen). Briefly, the chemosensory epithelia obtained from 5 to 10 mice (with a comparable sex ratio) were isolated and pooled in buffer RLT Plus supplemented with b-mercaptoethanol. Homogenization was performed through high-speed tissue disruption (TissueLyser II; Qiagen) and genomic DNA was removed from lysate by using the gDNA Eliminator spin column. Centrifugation and loaded processes were performed onto RNeasy spin columns to finally elute the total RNA in 30 μl of RNase-free water. Reverse transcription (RT) was then initiated with the cDNA synthesis kit (PrimeScript^TM 1st strand cDNA Synthesis Kit; Takara) using 140 ng of RNA and the random hexamers option to obtain a final volume of 20 μl of cDNA.