Primed template was prepared by annealing oligonucleotide JY180 (500 nM) (sequence: Key Resources Table ) to M13mp18 ssDNA (50 nM) (New England Biolabs) in 10 mM Tris-Cl pH 7.6, 5 mM EDTA and 100 mM NaCl. The sample was heated to 75°C and slowly cooled to room temperature. Unannealed oligonucleotide was removed with an S400 column (GE Healthcare). Assays (10 μl) were performed at 30°C in a buffer containing 25 mM HEPES-KOH (pH 7.6), 100 mM potassium glutamate, 0.01% NP-40-S, 1 mM DTT, 10 mM Mg(OAc)2, 0.1 mg/ml BSA, 3 mM ATP, 400 μM CTP, GTP, UTP, 30 μM dATP, dCTP, dGTP, dTTP, 33 nM α-[32P]-dCTP, 20 nM Pol α and RPA (0-400 nM). RPA was first pre-bound to the template in the absence of Pol α for 10 min. Reactions were initiated by addition of Pol α and were incubated for 20 min. Samples were processed and run through alkaline agarose gels as described for soluble replication reactions.
S400 column
Manufactured by GE Healthcare
The S400 column is a laboratory equipment product designed for size exclusion chromatography. It is used to separate and purify molecules based on their size and molecular weight.
Automatically generated - may contain errors
Lab products found in correlation
5 protocols using s400 column
1
Pol α DNA synthesis assay
2
Optimized Fab-PEG Conjugation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In all conjugations, Fab was coupled to PEG via covalent attachment of maleimide activated termini to the c-terminal cysteine of the antibody fragment as previously described [16 (link),26 (link)]. Each PEG was dissolved in 25 mM sodium acetate, pH 5.0 to limit maleimide hydrolysis. Prior to each conjugation, the Fab pool was titrated to pH 6.5 using 1 M (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (HEPES) at pH 7.2. Protein and polymer were mixed together at 2X molar excess over reactive maleimide. Conjugation pools were held overnight at room temperature. Following conjugation, the protein-polymer pools were buffer exchanged using a preparative scale GE Healthcare S-400 column in 20 mM histidine acetate, 50 mM NaCl pH 5.5 and fractionated to remove unreacted Fab and species with incomplete conjugation as previously described [26 (link)]. When necessary, formulations were concentrated using Amicon Ultra-15 (30,000 MWCO) spin concentrators and filtered using a Nalgene 0.2 μ m filter.
3
Ribosome Profiling Library Preparation
4
Oligomeric State Determination of HSF1
5
Primed Template Primer Extension Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primed template was prepared by annealing 500 nM oligonucleotide (sequence: 5′‐GAATAATGGAAGGGTTAGAACCTACCAT) to 50 nM M13mp18 ssDNA (New England Biolabs) in 10 mM Tris–HCl pH 7.6, 100 mM NaCl and 5 mM EDTA. The mixture was heated to 75°C and gradually cooled to room temperature. Unannealed oligonucleotide was removed using S400 column (GE Healthcare). The primer extension reaction was performed at 37°C in a buffer containing 25 mM HEPES‐KOH (pH 7.6), 100 mM potassium glutamate, 0.01% NP‐40‐S, 1 mM DTT, 10 mM Mg(OAc)2, 0.1 mg/ml BSA, 3 mM ATP, 400 μM CTP, GTP, UTP, 30 μM dATP, dCTP, dGTP, dTTP, 33 nM α‐[32P]‐dCTP. 1 nM primed templated was pre‐incubated with 250 nM RPA for 5 min. 20 nM PCNA and 4 nM RFC were added, and the reaction was initiated by the addition of 20 nM Pol ε. Aliquots were removed at the indicated time points and stopped with 50 mM EDTA. Unincorporated nucleotide was removed with illusta MicroSpin G‐50 columns (GE Healthcare), and samples were run on 0.6% alkaline agarose gel at 23 V for 16 h. The gel was fixed with cold 5% trichloroacetic acid and dried onto Whatman paper. The gel was exposed on BAS‐IP MS Storage Phosphor Screen (GE Healthcare), and screen was developed on a Typhoon laser imager (GE Healthcare).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!