Log In Sign up
The largest database of trusted experimental protocols

Abi stepone pcr system

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States

The ABI StepOne PCR System is a real-time PCR instrument designed for gene expression analysis and genetic variation studies. It provides accurate and reliable data for a wide range of applications, including gene expression profiling, SNP genotyping, and relative quantification.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (5 mentions) Ecodry premix kit, by Takara Bio (4 mentions) Sybr premix kit, by Takara Bio (3 mentions) Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (3 mentions) Taqman rna to ct 1 step kit, by Thermo Fisher Scientific (2 mentions) Sybr premix ex taq, by Takara Bio (2 mentions) Trizol, by Thermo Fisher Scientific (2 mentions) Nanodrop 2000, by Thermo Fisher Scientific (2 mentions) Trizol reagent, by Takara Bio (1 mentions) Primescript rt master mix, by Takara Bio (1 mentions) Hieff unicon qpcr sybr green master mix, by Vazyme (1 mentions) M mlv transcriptase, by Promega (1 mentions) Sybr green master mix, by DBI Bioscience (1 mentions) Rnaiso plus, by Takara Bio (1 mentions) Chamq sybr qpcr master mix kit, by Vazyme (1 mentions) Hiscript 3 rt supermix for qpcr kit, by Vazyme (1 mentions) Mirna universal sybr qpcr master mix, by Vazyme (1 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions) Powerup sybr green master mix kit, by Thermo Fisher Scientific (1 mentions) Rneasy plant mini kit, by Qiagen (1 mentions)

Close spelling variants of this product

ABI StepOne Real-Time PCR System (398 citations) StepOne (326 citations) StepOne system (296 citations) ABI StepOne system (86 citations) StepOne PCR system (70 citations) ABI StepOne (66 citations) ABI StepOne Plus Real-Time PCR Detection system (11 citations) ABI StepOne RT‐PCR System (9 citations) ABI RT-PCR StepOne Plus System (5 citations) ABI StepOne Real-time PCR Detection System (2 citations)

13 protocols using abi stepone pcr system

1

Quantitative RT-PCR for spsQ Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from log-phase bacterial cultures using a commercial kit (MoBio Ultra Clean RNA Isolation kit, # 15800–50) according to the manufacturer's protocol. Quantitative reverse-transcriptase PCR (RTqPCR) for spsQ was performed using the TaqMan RNA-to-CT 1-Step kit on an ABI StepOne PCR System (Applied Biosystems) using the primer-probe set: 5′-/56-FAM/CGCCAAGTT/ZEN/TCGATGAAGCGCAA/3IABkFQ/-3′, 5′-CCGTTACGTTGCTCTTCAGTA-3′, 5′-TAACCAAACACCTACACAACCT-3′. The following cycling conditions were performed: 48°C for 30 minutes, 95°C for 10 minutes, 95°C for 15 seconds and 40 cycles of 60°C for 1 minute. qPCR data were analyzed by the 2−ΔΔCT method and normalized against 16S rRNA as the endogenous control as previously described.54 (link)
Balachandran M., Bemis D.A, & Kania S.A. (2018). Expression and function of protein A in Staphylococcus pseudintermedius. Virulence, 9(1), 390-401.
+ Open protocol
+ Expand
2

Quantifying Gene Expression in Granulosa Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from GCs was extracted using TRIzol reagent (TaKaRa Biotechnology Co. Ltd., Tokyo, Japan) as described by the manufacturer. RNA concentrations were measured using a NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, USA). Gene expression was measured by real-time PCR analysis using SYBR Premix Ex Taq (TaKaRa, DRR420A) on an ABI StepOne PCR system (Applied Biosystems, Foster City, USA). The relative expression of each target gene was normalized to that of β-actin. The primer sequences were as follows: HO-1forward primer 5′-CAAGGTGCAAGACTTGGCT-3′, reverse primer 5′-CCAGAAAGCTGAGTGTGAGG-3′; β-actin forward primer 5′-GAGGCTCAGAGCAAGAGAGG-3′, reverse primer 5′-TGCCAGATCTTCTCCATGTC-3′ (Supplementary Table S1).
Wang Y., Yang C., Elsheikh N.A., Li C., Yang F., Wang G, & Li L. (2019). HO-1 reduces heat stress-induced apoptosis in bovine granulosa cells by suppressing oxidative stress. Aging (Albany NY), 11(15), 5535-5547.
+ Open protocol
+ Expand
3

RNA Isolation and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and reversely transcribed to single-stranded cDNA with RNA to cDNA EcoDry™ Premix Kit (Takara, Kusatsu, Shiga Prefecture, Japan). Real-time polymerase chain reaction (PCR) was conducted using SYBR Premix Kit (Takara) on the ABI Stepone PCRSystem (Applied Biosystems, Foster City, CA, USA). Relative expression of each gene was normalized to β-actin mRNA or GAPDH mRNA for mouse and human samples, respectively. Primer sequences used are described in Supplemental Table 1.
Yan Y., Zheng L., Du Q., Yazdani H., Dong K., Guo Y, & Geller D.A. (2021). Interferon Regulatory Factor 1(IRF-1) activates anti-tumor immunity via CXCL10/CXCR3 axis in Hepatocellular Carcinoma (HCC). Cancer letters, 506, 95-106.
+ Open protocol
+ Expand
4

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and reversely transcribed to single-stranded cDNA with RNA to cDNA EcoDry™ Premix Kit (Takara, Kusatsu, Shiga Prefecture, Japan). Then, real-time polymerase chain reaction (PCR) was performed using SYBR Premix Kit (Takara) on the ABI Stepone PCRSystem (Applied Biosystems, Foster City, CA, USA). Relative expression of each gene was normalized to β-actin mRNA or GAPDH mRNA for mouse and human studies, respectively. Primer sequences used in this study were provided in Supplementary Table 1.
Yan Y., Zheng L., Du Q., Yan B, & Geller D.A. (2020). Interferon regulatory factor 1 (IRF-1) and IRF-2 regulate PD-L1 expression in hepatocellular carcinoma (HCC) cells. Cancer immunology, immunotherapy : CII, 69(9), 1891-1903.
+ Open protocol
+ Expand
5

Quantitative Analysis of Liver β-Catenin mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from liver and hepatocytes was extracted by Trizol reagent (Invitrogen). 2ug of total RNA was reversely transcribed into cDNA with RNA to cDNA Ecodry Premix Kit (Takara). Then, PCR was performed using SYBR Premix Kit (Takara) on an ABI Stepone PCRSystem (Applied Biosystems). The relative expression of mRNA was quantitated using the 2-ΔΔCt method and normalized to β-actin. Primers used were: β-actin Forward 5`tgttaccaactgggacgaca3`, Reverse5`ggggtgttgaaggtctcaaa3`; β-catenin Forward 5`TGGACCCTATGATGGAGCATGA3`, Reverse5`GGTCAGTATCAAACCAGGCCAG3`
Yan B., Luo J., Kaltenmeier C., Du Q., Stolz D.B., Loughran P., Yan Y., Cui X, & Geller D.A. (2020). Interferon Regulatory Factor-1 (IRF1) activates autophagy to promote liver ischemia/reperfusion injury by inhibiting β-catenin in mice. PLoS ONE, 15(11), e0239119.
+ Open protocol
+ Expand
6

Quantitative RT-PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated with TRIzol (Invitrogen) and reverse-transcribed into cDNA using PrimeScriptTM RT Master Mix (Takara). Quantitative RT-PCR was performed with Hieff UNICON qPCR SYBR Green Master Mix (Vazyme) and gene specific primers (see Table S2 for primer sequences) on the ABI StepOne PCR system (Applied Biosystems). The specificity of each PCR amplification was verified by melting curve analysis, and the data were normalized to the amount of Tuba1a expressed.
Wu G., Li C., Tao J., Liu Z., Li X., Zang Z., Fu C., Wei J., Yang Y., Zhu Q., Zhang J.Q., Shen M, & Liu H. (2022). FSH mediates estradiol synthesis in hypoxic granulosa cells by activating glycolytic metabolism through the HIF-1α–AMPK–GLUT1 signaling pathway. The Journal of Biological Chemistry, 298(5), 101830.
+ Open protocol
+ Expand
7

Quantitative RT-PCR for Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNAiso Plus (Takara) was used to extract total cellular RNA, which was reverse-transcribed into cDNA with M-MLV transcriptase (Promega). Quantitative RT-PCR was performed on an ABI StepOne PCR System (Applied Biosystems) with SYBR Green Master Mix (DBI Bioscience), with an initial denaturation of 95°C for 10 min, and followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. GAPDH was used as an internal control. Primer sequences are listed in Table S1.
Liu J., Shi L., Huang W., Zheng Z., Huang X, & Su Y. (2022). Homoharringtonine Attenuates Dextran Sulfate Sodium-Induced Colitis by Inhibiting NF-κB Signaling. Mediators of Inflammation, 2022, 3441357.
+ Open protocol
+ Expand
8

Quantifying mRNA and miRNA Expression

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was prepared from cells using TRIzol reagent (Ambion, Austin, TX, United States) according to the manufacturer’s instructions. RNA quality was measured using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, United States). Approximately 500 ng of RNA was used for cDNA synthesis with a HiScript III RT SuperMix for qPCR kit (Vazyme, Nanjing, China). ChamQ SYBR qPCR Master Mix Kit (Vazyme) was used to quantify mRNA expression, and GAPDH was used as an internal control. The mRNA primers are described in Table 1. For the specific detection of miR-192-5p expression, the stem-loop real-time PCR was performed as previously described (Chen et al., 2005 (link)). Approximately 1 μg of RNA was used for cDNA synthesis with a miRNA 1st Strand cDNA Synthesis Kit (by stem-loop) (Vazyme). The miRNA Universal SYBR qPCR Master Mix (Vazyme) was used to quantify miR-192-5p expression, and RNU6 was used as an internal control. The miRNA primers for reverse transcription and quantification are described in Table 2. PCR reactions were conducted on ABI StepOne PCR system (Applied Biosystems, Foster City, CA, United States) and results were analyzed with the ΔΔCt method.
Jia Z., Wang K., Zhang Y., Duan Y., Xiao K., Liu S, & Ding X. (2021). Icariin Ameliorates Diabetic Renal Tubulointerstitial Fibrosis by Restoring Autophagy via Regulation of the miR-192-5p/GLP-1R Pathway. Frontiers in Pharmacology, 12, 720387.
+ Open protocol
+ Expand
9

Quantification of VEGF-A Isoforms in FFPE Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols
Archived formalin-fixed paraffin-embedded tumor tissue blocks were obtained for 22 patients. RNA was isolated from six- 10mm cut sections using the Ambion Recoverall Total Nucleic Isolation kit according to manufacturer’s protocol (Ambion-Life Technologies, Austin, TX, USA). RNA (200ng) from each sample was reverse transcribed using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems-Life Technologies, Foster City, CA, USA). Taqman quantitative PCR was performed for VEGF-A (Cat# Hs00900055_m1), NRP1 (Cat# Hs01546494_m1), NRP2 (Cat# Hs01033058_m1), and GAPDH (Cat# Hs00266705_g1) expression, using the ABI StepOne PCR System (Applied Biosystems- Life Technologies, Foster City, CA, USA). Primers for specific VEGF-A isoforms were as follows: VEGFA121 (forward, ACAACAAATGTGAATGCAGACCAAA; reverse, CTGAGGGAGGCTCCTTCCT), VEGFA145 (forward, GCAAGAAATCCCGGTATAAGTCC; reverse, GCTCACCGCCTCGGC), VEGFA165 (forward, ACAACAAATGTGAATGCAGACCAAA; reverse, GCTTTCTCCGCTCTGAGCAA), VEGFA189 (forward, GCGCAAGAAATCCCGGTATAAGT; reverse, GCTTTCTCCGCTCTGAGCAA), VEGFA206 (forward, TGTCTAATGCCCTGGAGCCT; reverse, AATGCTTTCTCCGCTCTGAGC). mRNA expression were normalized to GAPDH mRNA and expressed as DCT= [CT(NRP) - CT(GAPDH)], where CT is the threshold cycle.
Rangwala F., Bendell J., Kozloff M., Arrowood C., Dellinger A., Meadows J., Tourt-Uhlig S., Murphy J., Meadows K.L., Starr A., Broderick S., Brady J.C., Cushman S.M., Morse M., Uronis H., Hsu S.D., Zafar S.Y., Wallace J., Starodub A., Strickler J., Pang H., Nixon A.B, & Hurwitz H. (2014). Phase I Study of Capecitabine, Oxaliplatin, Bevacizumab, and Everolimus in Advanced Solid Tumors. Investigational new drugs, 32(4), 700-709.
+ Open protocol
+ Expand
10

Quantitative Real-Time PCR Analysis of spa and srtA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from log phase bacterial cultures using a commercial kit (MoBio Ultra Clean RNA Isolation kit, MoBio, Carlsbad, CA) according to the manufacturer’s protocol. Quantitative Real-Time PCR (qPCR) for spa and srt A were performed using the TaqMan RNA-to-CT 1-Step kit on an ABI StepOne PCR System (Applied Biosystems, Foster City, CA). The primers and probe used for the qPCR are listed in Table 1. The following cycling conditions were performed: 48°C for 30min, 95°C for 10min, 95°C for 15s, 60°C for 1min (40 cycles). qPCR data were analyzed by the ΔΔCT method and normalized against 16S rRNA as the endogenous control as previously described [35 (link)].
Balachandran M., Giannone R.J., Bemis D.A, & Kania S.A. (2017). Molecular basis of surface anchored protein A deficiency in the Staphylococcus aureus strain Wood 46. PLoS ONE, 12(8), e0183913.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!