Brilliant 2 ultra fast sybr green qpcr master mix

PnuC gene levels were analyzed by qPCR. Total RNA was extracted using RNeasy Kit (Qiagen, USA) from whole bacteria according to the manufacturer’s instructions. Total extracted RNA was quantified in NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). cDNA was produced using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). 1 µg of cDNA [TG1] was used for qPCR reaction using Brilliant II Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies, Santa Clara, CA, USA). Levels of mRNAs were normalized to 16S gene levels using the ΔΔCT method. Primers for the PnuC promoter were: forward TCATGGATCGAAGCGGTAGG; reverse CAAGGTGACGTTGATCAGGC. Primers for the 16S promoter were: forward ACTCCTACGGGAGGCAGCAG; reverse ATTACCGCGGCTGCTGG.

Total RNA was isolated from cell lines and breast tissues using TRIzol reagent (Thermo Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. First-strand cDNA was prepared from 1 μg of total RNA in a total reaction volume of 20 μL using M-MLV reverse transcriptase 200 U/µL (Promega, Madison, WI, USA) at 42 °C for 60 min. The qPCR analysis was performed using Brilliant II Ultra-Fast SYBR^® Green qPCR Master Mix according to the manufacturer’s protocol on the Stratagene Mx-3000p system (Agilent Technologies, Santa Clara, CA, USA). Relative expression was calculated by the 2^−ΔΔCt methods, with RNA18S5 and ACTB genes as controls. The primer sequences are detailed in Table 1.

The expression profile of molecular markers involved in CDDP resistance (ABCC2, ATP7A and CTR1 genes), as well as the expression profile of genes obtained by subsequent RNA-seq analysis (SERPINA1, BTC and CCL5 genes) were performed by qRT-PCR. Total RNA was extracted from ~2.0 x10⁶ cells using TRIzol Reagent (Thermofischer, USA) according to the manufacturer’s instructions. RNA concentration and integrity were evaluated at 260 nm using the Infinite®NanoQuant spectrophotometer (TECAN, Switzerland) and by gel electrophoresis. Then, RNA was treated with DNase I (Promega Corp, USA) and first-strand cDNA was prepared from 2 μg of RNA in a total reaction volume of 20 μL using M-MLV reverse transcriptase 200 U/μL (Promega Corp, USA) at 42°C for 60 min. Subsequently, cDNA was amplified by qPCR using Brilliant II Ultra-Fast SYBR® Green qPCR Master Mix according to the manufacturer’s protocol in the Stratagene Mx-3000p real-time PCR system (Agilent Technologies, USA). Relative expression was determined using the 2^-ΔΔCT method, using ACTB as the reference gene. Sequences of oligonucleotides used in this study are detailed in Table 1.

RNA was extracted from dorsal and ventral hippocampi with miRNeasy kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. The concentration of each RNA sample was determined by Nanodrop 2000 (Thermo Scientific, USA) and integrity was evaluated by denaturing gel electrophoresis. RNA was reverse transcribed into cDNA by using Superscript II (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions and as was reported previously (Castañeda et al., 2015 (link)). RT-qPCR experiments were conducted on the Stratagene Mx3000p thermocycler (Stratagene, Agilent), programmed as follows: 95°C for 10 min followed by 40 cycles of 95°C for 15 s, 60°C for 15 s and 72°C for 20 s. Each reaction was carried out in duplicate and consisted of 10 μl Brilliant II Ultra-fast SYBR Green QPCR Master Mix (Agilent Technologies), an appropriate dilution of RT and 0.12 μM of the forward and reverse primers designed using Primer-Blast, NCBI and obtained from Integrated DNA Technologies (Coralville, IA, USA). The sequence of primers is shown in Table 1. Standard curves for all primer sets were conducted with serial dilutions of cDNAs, and specificity was validated using melting curve analyses. Relative gene mRNA levels were calculated based on the 2^−ΔΔCT for each mRNA, and normalized to that of the β-actin housekeeping gene mRNA.