Real time pcr primers

All the chemicals used were of analytical grade and purchased from commercial sources as indicated: Real-time PCR primers from Invitrogen (Carlsbad, CA, USA), M-MLV reverse transcriptase, reverse transcription buffer and 0.1 M DTT, platinum Sybr green qPCR-UDG mix from Invitrogen (Groningen, The Netherlands), dNTPs, protector RNase inhibitor, primer oligo(DT)₁₅ for cDNA synthesis and salmon sperm DNA from Roche (Mannheim, Germany).

RNA was isolated from liver fibrosis tissues or the HSCs by using Trizol Reagent (Invitrogen) according to the manufacturer’s instructions. Total RNA quality and density were assessed by using the Thermo Scientific NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific, United States). To qualify miRNA or mRNA, RNA was reverse transcribed to cDNA by using transcriptor first-strand cDNA synthesis kit (Bio-Rad, United States) following the manufacturer’s protocols. After that, real-time PCR was carried out in a detection system with SYBR-Green Master Mix (Bio-Rad). Real-time PCR primers were acquired from Invitrogen. For the miR-145 expression analysis, the one-step miRNA real-time PCR Detection Kit (biomics, Nantong, Jiangsu, China) was used according to the manufacturer’s protocols. U6 small nuclear was used as endogenous control. All of measurements were performed three times and GAPDH was used as an endogenous control for mRNA expression. The following primers of genes were used:

Total mRNA was extracted by a commercial mRNA extraction kit (Invitrogen, Carlsbad, CA ). 2 μg of RNA were reverse-transcripted into cDNA using oligo dT primers. Real-time PCR primers for HDAC3 were synthesized by Invitrogen. Forward primer: GCTGGAGGGAAAAGGAGTGG; Reverse primer: GGCCTTGGGAGAGAGAGGAA. PCR was carried out at 94°C for 30 s, 55°C for 30 s and 72°C for 45 s for 30 cycles, using ABI prism 7700 sequence detector and software to analyze the data (Applied Biosystems, CA).

Human umbilical vein endothelial cells (HUVECs; Promocell, Germany; Passage ≤6) were maintained in EGM-2. Confluent HUVECs were exposed to DEP (10–150 μg/mL) or vehicle (medium alone) for 2–24 h. Following exposure, cells and supernatants were stored (−80 °C) for subsequent analysis. Alternatively, DEP suspensions were removed and the cells stimulated with thrombin (0.1–1 U/mL; 24 h) before harvesting. The effect of DEP on cell viability was assessed by LDH assay (Cyotoxicity Detection kit; Roche Diagnostics, UK).
Concentrations of t-PA (antigen and activity) and PAI-1 (activity) in HUVEC supernatants were measured by ELISA, to manufacturer’s instructions (t-PA Combi Actibind ELISA kit and TECHNOZYM® PAI-1 Actibind® ELISA kit; Technoclone Ltd, UK). RNA was extracted from HUVECs and reverse transcribed to cDNA in order to measure t-PA and PAI-1 expression by real time polymerase chain reaction (PCR). Real time PCR primers (Invitrogen; UK; Additional file 3: Table S1) and probes (Roche Universal Probe library) were designed by the Roche UPL Design Centre (Roche, UK) using the species-specific gene and nucleotide sequences. Samples were analysed using a Roche LightCycler 480 and normalised to the housekeeping genes GAPDH and β-actin. Additional reagents were purchased from Sigma-Aldrich (UK).

All chemicals used were of analytical grade and purchased from commercial sources as follows: real-time PCR primers, M-MLV reverse transcriptase, reverse transcription buffer, 0.1 M dithiothreitol (DTT), Platinum SYBR green qPCR UDG mix were from Invitrogen (Carlsbad, CA, USA); dNTPs, Protector RNase inhibitor, Klenow enzyme, primer oligo (dT)15 for complementary DNA (cDNA) synthesis and Salmon sperm DNA were from Roche (Penzberg, Germany); Hybond N nylon membranes were purchased from Amersham Pharmacia Biotech (Amersham, UK), 4,6-diamidino-2-phenylindole (DAPI) from Southern Biotech (Birmingham, AL, USA). All other reagents and chemicals were from Sigma-Aldrich (St. Louis, MO, USA) or Merck (Darmstadt, Germany).

We isolated RNA from brain tissue at indicated timepoints following tMCAO. Hemispheres were separated and homogenized in TRIzol Reagent (1 ml per 100 mg tissue), chloroform was added, samples were centrifuged at 12,000×g for 15 min at 4 °C and the upper aqueous phase was collected. RNA was precipitated by the addition of isopropyl alcohol, washed and dissolved in TE-Buffer. We isolated total RNA from cells using QIA-Shredder spin columns and the RNeasy Micro Kit (QIAGEN) and transcribed complementary DNA using Maxima First Strand cDNA Synthesis Kit for RT-qPCR (Fermentas). Real-time PCR primers were obtained from Applied Biosystems (Carlsbad, CA): Il6: Mm00446190_m1; Il23: Mm00518984_m1; Il1b: Mm00434228_m1; Tgfb: Mm01178820_m1; Cxcl1 Mm00433859_m1; Mmp3: Mm00442991_m1; BActin: Mm00607939_s1, Sdha: Mm01352366_m1. Probe mixtures were purchased from Fermentas (Waltham, MA). The relative gene expression was calculated using the ΔΔCt method and the samples were normalized to the control population and the expression of Sdha or β-Actin. Samples were randomized and coded by an independent researcher, so experiments were carried out blindly.