An shRNA negative (control), an shRNA targeting SIRT1 and an shRNA targeting ATG5 were created. For each one, a pair of oligonucleotides was designed. The sequences of each pair of oligonucleotides can be found in the Supplementary Experimental Procedures. Each pair of oligonucleotides were annealed and inserted in linearized p-ENTR/pSUPER+ (AddGene 575-1). The H1-shRNA cassette was then transferred, with LR clonase recombination system, into SIN-cPPT-PGK-EGFP-WHV-LTR gateway destination vector. See Supplementary Table 1 for more details.
P entr psuper
Manufactured by Addgene
Sourced in United States
The P-ENTR/pSUPER+ is a plasmid vector used for gene expression and RNA interference studies. It contains an entry site for Gateway cloning and a promoter for expression of short hairpin RNA (shRNA) constructs. The plasmid also includes a selectable marker for antibiotic resistance.
Automatically generated - may contain errors
Lab products found in correlation
3 protocols using p entr psuper
1
Generating Targeted shRNA Constructs
2
Lentiviral Transduction of miRNA Precursors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human APP coding sequence (CDS) was directly amplified from the cDNA of 3xTg-AD mice and cloned into the pIS0 vector (Addgene, USA)69 (link), upstream of the luciferase reporter gene. Colonies with the desired insertion were screened by PCR and further validated by sequencing. Lentiviral plasmids encoding the endogenous precursor sequence of each miRNA (precursor [pre-]miRNAs) and the NC (Invitrogen, USA) were generated by amplifying the precursor sequence and inserting the sequence in the linearized pENTR/pSUPER+ (#575-1, Addgene, USA). The H1-miRNA cassette was then transferred, employing the LR clonase recombination system, into a gateway pLenti CMV GFP destination vector (#736-1, Addgene). Lentiviral particles encoding the precursor sequence of pri-miR-31 were produced in HEK293 cells as previously described.70 (link) Lentiviral particles were resuspended in 1% BSA in sterile PBS. The viral particle content of each batch was determined by quantifying the HIV-1 p24 antigen by ELISA (Retro-Tek kit; Gentaur, France), and batches were kept at −80°C until use.
3
Lentiviral shRNA Knockdown of Mouse DPP-IV
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A negative short hairpin RNA (shRNA) (control) and shRNA targeting mouse DPP-IV were created. For each one, a pair of oligomers was designed. The sequences of each pair of oligomers used were: shRNA control (top 5′ GATCCCCCAACAAGATAAGAGCACCAATTCAA GAGATTGGTGCTCTTCATCTTGTTG3TTTTTA 3′/bot 5′ AGCTTAAAAA CAACAAGATGAAGAGCACCAATCTCTTGAATT GGTGCTCTTCATCTTG TTGGGG 3′) and shRNA DPP-IV (top 5′ GATCCCCATAAGATCATCAG CGACAAAGTTCAAGAGACTTTGTCGCTGATGATCTTATTTTTTA 3′/bot 5′ AGCTTAAAAAATAAGATCATCAGCGACAAAGTCTCTTGAAC TTTGT CGCTGATGATCTTATGGG 3′). Each pair of oligomers were annealed and inserted in linearized (with BglII and HindIII restriction enzymes) pENTR/pSUPER + (AddGene 575-1). The H1-shRNA cassette was then transferred, with LR clonase recombination system, into SIN-cPPT-PGK-EGFP-WHV-LTR gateway vector.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!