Lentiviral shrnas

For AMPK, CaMKKβ, LKB1, and Skp2 knockdown, lentiviral packing plasmid and pLKO.1-puro-shRNA constructs (Sigma) were transfected into 293T cells using calcium phosphate method. After 36 h, the supernatant was collected, and MDA231 parental cells were infected and 2 µg/ml puromycin selected for a week. Knockdown efficiency was detected by western blot. For Skp2 WT, S256A, and S256D restore cell, Skp2 was cloned into pLKO.1 vector (Sigma). Mutants were generated by site-direct mutagenesis. The following lentiviral shRNAs (Sigma) are used: shLuc 5′-CGCTGAGTACTTCGAAATGTC; shSkp2-1 5′-GATAGTGTCATGCTAAAGAAT; shSkp2-2 5′-GCCTAAGCTAAATCGAGAGAA; shCaMKKβ 5′-CCGGGTGAAGACCATGATACGTAAACTCGAGTTTACGTATCATGGTCTTCACTTTTT; shLKB1 5′-CATCTACACTCAGGACTTCAC; shAMPKα1-1 5′-CCGGGTTGCCTACCATCTCATAATACTCGAGTATTATGAGATGGTAGGCAACTTTTT; shAMPKα1-2 5′-CCGGGTAGCTGTGAAGATACTCAATCTCGAGATTGAGTATCTTCACAGCTACTTTTTTG
For restoration experiments, we transiently transfected 5–10 μg DNA with turbofect (Thermo Fisher, R0531) into Skp2^-/- MEF cells, AMPKα^-/- MEF cells and CaMKKβ stably knockdown MDA-MB-231 cells, the detailed information was described in each figure legend.

Lentiviral shRNAs targeting AHR and non-targeting control were obtained from Sigma-Aldrich (St. Louis, MO, USA). Following transduction, H1975 cell lines were selected with 0.5 µg/ml puromycin for 7 days. Clones were established from the transduced populations using limiting dilution. After lentiviral transduction of cells with EGFP-ffluc-epHIV7 vector, GFP-positive cells were isolated using fluorescence-activated cell sorting.
For transient knockdown of ATF4, specific MISSION® esiRNA (Sigma-Aldrich, Munich, Germany) and MISSION® siRNA Universal Negative Control were introduced by RNAiMAX (Thermo Fischer Scientific, Waltham, MA, USA) according to the manufacturer’s protocol.
For sequences of shRNAs and siRNAs see Supplementary Table 2.

pBabe-GFP empty vector or pBabe-GFP-MYC vector63 (link), pMX-T7-2xFlag empty vector or pMX-T7-2xFlag-Menin vector (gift from Dr Xianxin Hua in University of Pennsylvania)64 (link) was co-transfected with plasmids encoding gag/pol and VSVG into HEK293T packaging cells using lipofectamine 2000 (Invitrogen). HT1080 cells were infected with produced retrovirus in the presence of polybrane and selected with 0.5 mg ml⁻¹ G418 or 0.5 μg ml⁻¹ puromycin to establish stale cells. Lentiviral shRNAs targeting human MYC, MEN1, ASH2L, RBBP5, CDK9, Cyclin T1 and SCD1 were purchased from Sigma. shRNA targeting sequences are listed in Supplementary Table 1. Viruses expressing shRNAs were produced in HEK293T cells and infected HT1080 or HepG2 cells in the presence of polybrane.