Mice were weaned 20–25 days after birth. Ear and tail pieces were taken from adult mice and embryos for genotyping, respectively. DNA extraction was performed using phenol-chloroform-isoamyl alcohol mixture (Sigma) as per protocol. Screening was performed by PCR using the following primers: Rb flox primers: forward 5′ GGCGTGTGCCATCAATG 3′ and reverse 5′ AACTCAAGGGAGACCTG 3′, Cre primers: forward 5′ TGACCAGAGTCATCCTTAGCG 3′ and reverse 5′AATGCTTCTGTCCGTTTGCC3′. Rb heterozygous embryos (Bf-1 Cre+/−;Rb flox/+) showed a similar phenotype to wild-type embryos (Bf-1 Cre +/−;Rb+/+) embryos and thus used as controls compared with Rb mutant mice (Bf-1 Cre+/−;Rb flox/flox).
Phenol chloroform isoamyl alcohol mixture
Manufactured by Merck Group
Sourced in United States
The Phenol-chloroform-isoamyl alcohol mixture is a laboratory reagent commonly used in the extraction and purification of nucleic acids, such as DNA and RNA, from biological samples. It is a biphasic solution that facilitates the separation of nucleic acids from proteins and other contaminants. The mixture consists of phenol, chloroform, and isoamyl alcohol in specific proportions.
Automatically generated - may contain errors
Lab products found in correlation
Glycoblue, by Thermo Fisher Scientific (3 mentions)
Dnase 1, by Promega (3 mentions)
Proteinase k, by Thermo Fisher Scientific (3 mentions)
Rnasin rnase inhibitor, by Promega (3 mentions)
Vanadyl ribonucleoside complexes solution, by Merck Group (3 mentions)
M2 agarose, by Merck Group (3 mentions)
Protease inhibitor cocktail, by Merck Group (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Dpni, by New England Biolabs (1 mentions)
Ethanol, by Merck Group (1 mentions)
Phosphate buffered saline (pbs), by Merck Group (1 mentions)
Rnase inhibitor, by Promega (1 mentions)
Protease inhibitor cocktail, by Roche (1 mentions)
Allprep dna rna 96 kit, by Qiagen (1 mentions)
5prime phase lock gel heavy tubes, by Quantabio (1 mentions)
Chloroform isoamyl alcohol mixture, by Merck Group (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Dnase 1, by Qiagen (1 mentions)
Protease inhibitor cocktail for mammalian tissues, by Merck Group (1 mentions)
Lysozyme from chicken egg white, by Merck Group (1 mentions)
22 protocols using phenol chloroform isoamyl alcohol mixture
1
Conditional Rb Gene Knockout in Mice
2
Mitochondrial DNA Extraction from Pancreatic Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pancreata from diabetic and non-diabetic mice (control) were used in protocols for isolating the mitochondria. Briefly, the pancreatic tissue was cut in pieces and added to 50 mL of medium (Hepes 10 mM, saccharose 250 mM e EGTA 1 mM) at pH 7.2 and homogenized for 15 s. Later, the pancreatic tissue was centrifuged at 600 g for 5 min, and the supernatant was collected and centrifuged at 2,000 g for 10 min. The pellet containing the isolated mitochondria was recovered. The mitochondria were sonicated at an amplitude of 100% (10 sonicagens of 30 s with 30 s intervals). Then, the suspension of lysed mitochondria was centrifuged at 12,000 g for 10 min at 4°C followed by centrifugation at 100,000 g at 4°C for 30 min. The supernatant from this centrifugation was used for DNA extraction with the phenol–chloroform–isoamyl alcohol mixture (Sigma-Aldrich). Finally, DNA quantitation was determined with a Nanodrop 2000 (Thermo Technologies).
3
Episomal DNA Isolation and AAV Transgene Replication
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Isolation of episomal DNA for the analysis of AAV transgene replication was performed as previously described.52 HEK293T cells were seeded in 10 cm dish and transfected with AAV packaging genes including ss-CAG-GFP. 48 h after triple transfection, cells were harvested and washed with DPBS. The cell pellet was incubated with 500 μL of Hirt lysis buffer for 10 min RT and followed by proteinase K digestion (50 μg/mL final concentration) for 1 h at 37°C. The reaction was stopped by adding 120 μL of 5 M NaCl, and tubes were kept at 4°C overnight to precipitate chromosomal DNA. Next day, samples were centrifuged for 1 h (17,000 g, 4°C), the supernatant was transferred to new tubes, and phenol/chloroform/isoamyl alcohol mixture (Sigma) was added. After centrifuging for 10 min, the upper layer was transferred, and sodium acetate was added. After overnight incubation at −20°C, the dried pellets were re-suspended with nuclease-free DW after washing with 70% ethanol. 1 μg of DNA was digested with DpnI (NEB) for 2 h at 37°C, followed by heat inactivation at 80°C for 20 min. qPCR was performed to measure the amount of replicated transgene using primers for ss-CAG-GFP.
4
Nuclear Extraction of Transduced Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
9L cells were plated on 48-well plates (70–80% confluent) and transduced with RGD4C-AAVP carrying the Luc gene (RGD-Luc) or control non-targeted fd-Luc vectors in serum-free medium for 4 hours with or without 2 hours pretreatment with genistein (150 μΜ). On day 4 after transduction, cells were harvested and nuclei were extracted as previously reported [42 (link)]. Cells were washed with phosphate buffered saline (PBS, Sigma), trypsinized and then pelleted by centrifugation at 1500 × g for 5 min. The pellet was washed with PBS and pelleted again by centrifugation at 1500 × g for 5 min. Subsequently, the pellet was resuspended in hypotonic buffer (20 mM Hepes-KOH, pH 8.0, 5 mM KCl, 1.5 mM MgCl2, 5 mM Sodiumbutyrate, 0.1 mM dithiothreitol [DTT]) and lysed by dounce homogenization. Nuclei were collected by centrifugation (10 min, 16,000 × g, 4°C) and resuspended in nuclear extraction buffer (15 mM Tris-HCl, pH 7.5, 1 mM EDTA, 0.4 M NaCl, 10% sucrose, 1 mM DTT). DNA was extracted using Phenol/Chloroform/Isoamyl alcohol mixture (Sigma) and precipitated by 100% ethanol (Sigma). The precipitates were washed with 80% ethanol and resuspended in 10 mM Tris-HCl, pH 8.5.
5
Cellular Fractionation and RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cellular fractionation was performed as described previously (Gao et al, 2015 (link)). Briefly, cells were washed with ice‐cold PBS, collected, spun down, and re‐suspended in ice‐cold buffer I (10 mM Hepes (pH 8.0), 1.5 mM MgCl2, 10 mM KCl, and 1 mM DTT) supplemented with protease inhibitor cocktail (Roche) and RNase inhibitor (Promega), followed by incubation for 15 min on ice to allow cells to swell. Igepal‐CA630 was then added at a final concentration of 1% (use 10% stock solution) followed by vortexing for 10 s. Nuclei were collected by centrifuging 2 ∼ 3 min at maximum speed. The resultant supernatant was cytosolic fraction. Nuclei were then lysed in ice‐cold buffer II (20 mM Hepes (pH 8.0), 1.5 mM MgCl2, 25% glycerol, 420 mM NaCl, 0.2 mM EDTA, and 1 mM DTT) supplemented with protease inhibitor cocktail and RNase inhibitor followed by vigorous rotation at 4°C for 30 min and centrifugation 15 min at maximum speed. The resultant supernatant was nuclear fraction. Both cytosolic and nuclear RNAs were extracted by Phenol‐Chloroform‐Isoamyl Alcohol mixture (Sigma‐Aldrich, 77618) followed by RT‐qPCR analysis.
6
Total RNA Isolation and Reverse Transcription
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For total RNA isolation, 650 µl of prepared tissue lysate was transferred along with 325 μl Phenol–Chloroform–isoamyl alcohol mixture (77617, Sigma-Aldrich) into 5PRIME Phase Lock Gel Heavy tubes (2302830, Quantabio), followed by vigorous shaking for 15 s and centrifugation at 16,000g for 5 min. Next, 325 µl of Chloroform–isoamyl alcohol mixture (25666, Sigma-Aldrich) was added and the tubes were shaken again for 15 s, followed by 3 min incubation and centrifugation at 16,000g for 5 min. 350 µl of aqueous phase was collected and used to extract total RNA and using AllPrep DNA/RNA 96 Kit (80311, Qiagen). Isolation was performed according to the manufacturer’s instructions with slight modification to remove DNA contamination from the RNA fraction. For this, the RNA fraction was loaded in the RNeasy® 96 Plate and washed with 400 µl RW1 buffer. 80 µl of DNase I (79254, Qiagen) was added to each well and the RNeasy® 96 Plate was incubated for 15 min at room temperature followed by standard protocol starting with washing the 96-well plate with RW1 buffer. Either 500 ng (dCas9-VPR, Ldlr and Pcsk9) or 1 µg (Serpina1(a-e)) of total RNA was reverse-transcribed into copy DNA (cDNA) using High-Capacity cDNA Reverse Transcription Kit (4368813, Applied Biosystems).
7
Cellular Fractionation and RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cellular fractionation was performed as described previously 88 (link). Briefly, cells were washed with ice-cold PBS, collected, spun down and re-suspended in ice-cold buffer I (10 mM Hepes, pH 8.0, 1.5 mM MgCl2, 10 mM KCl, 1 mM DTT) supplemented with protease inhibitor cocktail, followed by incubation for 15 min on ice to allow cells to swell. Igepal-CA630 was then added at a final concentration of 1% (use 10% stock solution) followed by vortexing for 10 s. Nuclei were collected by centrifuging 2∼3 min at maximum speed (∼21,100 × g). The resultant supernatant was cytosolic fraction. Nuclei were then lysed in ice cold buffer II (20 mM Hepes, pH 8.0, 1.5 mM MgCl2, 25% (v/v) glycerol, 420 mM NaCl, 0.2 mM EDTA, 1 mM DTT) supplemented with protease inhibitor cocktail followed by vigorous rotation at 4 °C for 30 min and centrifugation 15 min at maximum speed. The resultant supernatant was nuclear fraction. Both cytosolic and nuclear RNAs were extracted by Phenol-Chloroform-Isoamyl Alcohol mixture (Sigma, 77618) followed by RT-qPCR analysis.
8
RNA Immunoprecipitation and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA-IP was performed as previously described with minor modifications (Peritz et al., 2006 (link)). Briefly, cells grown in a 10-cm dish were lysed in polysome lysis buffer (100 mM KCl, 5 mM MgCl2, 10 mM HEPES, pH 7.0, 0.5% NP-40, 1 mM DTT, 100 U/ml RNasin RNase inhibitor (Promega, N2511), 2 mM vanadyl ribonucleoside complex solution (Sigma, 94742), and 25 μl/ml protease inhibitor cocktail for mammalian tissues (Sigma, P8340)) and then subjected to IP followed by washing with polysome lysis buffer four times and then polysome lysis buffer plus 1 M urea four times. RNA was released by adding 150 μl of polysome lysis buffer with 0.1% SDS and 45 μg proteinase K (Ambion, AM2548) and incubated at 50°C for 30 min. RNA extracted with a phenol-chloroform–isoamyl alcohol mixture (Sigma, 77618) was recovered by adding 2 μl GlycoBlue (15 mg/ml, Ambion, AM9516), 36 μl 3 M sodium acetate and 750 μl ethanol followed by incubation at −20°C overnight. Precipitated RNAs were washed with 70% ethanol, air dried, and resuspended in RNase-free water followed by DNase I (Promega, M6101) treatment to remove genomic DNA. The resulting RNAs were subjected to RT–qPCR analysis.
9
Acinetobacter baylyi ADP1 Genomic DNA Isolation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Acinetobacter baylyi ADP1 genomic DNA was prepared from overnight liquid cultures grown in MAS (Medium for Acinetobacter Supplemented) broth at 30°C with shaking to an O.D.600 of approximately 1.5. Cells were pelleted and lysed in the presence of Lysozyme from chicken egg white (Sigma, St. Louis, MO, USA). Genomic DNA was purified by phenol-chloroform (Phenol-chloroform-isoamyl alcohol mixture, Sigma) phase extraction. Extracted DNA was resolved in 100 μL TE buffer (10 mM Tris, 1 mM EDTA [pH 8.0]) supplemented with 10 μg/mL RNase (Sigma).
10
Total RNA Extraction from Bryophyte Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A modified Trizol prep was used to extract RNA (Chomczynski and Sacchi, 1987 (link)). We mixed 500 µl of Solution D [4 M guanidine isothiocyanate, 25 mM sodium citrate (pH 7.0), 0.5% sarkosyl], 500 µl phenolchloroform-isoamyl alcohol mixture (Sigma-Aldrich; 77618) and 50 µl 2 M sodium acetate (pH 4) and added to 30 mg of frozen ground, S. kraussiana shoot tips. The solution was vortexed for 10 s and the supernatant transferred to a new tube. After 5 min at room temperature, 200 µl chloroform:isoamyl alcohol 24:1 (Serva; 39554.02) was added and incubated for 5 min. The samples were centrifuged at 12,000 g for 15 min at 4°C. Then 500 µl of the top aqueous layer was added to 500 µl isopropanol. After 10 min incubation at room temperature, solutions were mixed by inverting, then centrifuged at 12,000 g for 10 min at 4°C. The white RNA pellet was washed in 100% ethanol, centrifuged again at 7500 g for 4 min at 4°C, air dried, then resuspended in 30 µl DEPC H20. RNA quality was checked by gel electrophoresis and concentrations were determined using a NanoPhotometer® N60 (Implen).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!