All candidate genes were selected for validation using qRT-PCR. The gene-specific primers that were designed according to the gene sequences from the ‘TO1000’ reference genome by Primer Premier software, version 5.0 (Premier Biosoft International, Palo Alto, CA, USA) are listed in Table S1 . First-strand cDNA was synthesized using the PrimeScript RT Reagent Kit (TAKARA BIO, Inc., Shiga, Japan). qRT-PCR was performed using SYBR Premix Ex Taq II (Tli RNase HPlus; TAKARA BIO, Inc., Shiga, Japan) on an ABI Prism® 7900HT (Applied Biosystems, Carlsbad, CA, USA) according to the manufacturer’s instructions. The conditions for amplification were as follows: 15 min denaturation at 95 °C; 40 cycles of 95 °C for 10 s and 60 °C for 20 s; and 72 °C for 25 s. Three technical replicates were performed for each gene. The relative changes in gene expression levels were normalized to the expression of the Medicago actin gene (AF044573) and calculated calculated using the 2−ΔΔCT method [37 (link)].
Primer premier software version 5
Manufactured by Premier Biosoft
Sourced in United States
Primer Premier software version 5.0 is a bioinformatics tool designed for primer design. It allows users to input DNA sequences and generate optimal primer pairs for various applications, such as PCR, sequencing, and qPCR.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Abi prism 7900ht, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Sybr premix ex taq 2 tli rnaseh plus, by Takara Bio (1 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix kit, by Takara Bio (1 mentions)
Rt platinum taq mix, by Thermo Fisher Scientific (1 mentions)
Takara rna pcr kit, by Takara Bio (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Tiangel midi purification kit, by Tiangen Biotech (1 mentions)
9 protocols using primer premier software version 5
1
Quantitative RT-PCR Validation of Candidate Genes
2
Differentiation of GPVs and MDPVs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Previous studies demonstrated that the NS gene homology between GPVs (cGPVs and N-GPVs) and MDPVs ranged from 80.8 to 83.4% and can be used for GPVs and MDPVs differentiation [18 (link), 19 (link)]. After a bioinformatics analysis of the NS genes of GPVs (cGPVs and N-GPVs) and MDPVs specific primers and a probe were designed using Primer Premier Software version 5.0 (Premier Biosoft, Palo Alto, CA, USA) following a similar strategy that we used to develop a specific TaqMan-based real-time PCR for MDPV. Detailed information regarding the primers and probe is shown in Table 1 . The amplicon was 158-bp in length. The GPV-qF (5′- TAGGGAGGAGTTAGAAGA-3′), the GPV-qR (5′- CATCCATAGAATTGTCATAAGTA-3′), and the GPV-qP (FAM-5′- ACCTGGTAATTGTTCYTGCTTCTCT-3′-Eclipse) were synthesized by a commercial company (TaKaRa, Dalian, China).
3
Molecular Diagnostics for MDPV Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primer and probe selection was performed on the evolutionarily most conserved regions of the NS gene of MDPV. Briefly, a total of 15 MDPVs and 37 GPVs NS gene sequences were downloaded from the GenBank database (https://www.ncbi.nlm.nih.gov/nucleotide/ ), and these 52 NS gene sequences were aligned using the Lasergene package MegAlign program by ClustalW method. The identification of the conserved region, which was highly conserved in MDPVs, but there was a characteristics variation in GPVs. The obvious different region between MDPVs with GPVs, was selected for the primers and TaqMan probe design. The forward primer MDPV-qF (5’-TACGAATGAACAAACCAA-3′), the reverse primer MDPV-qR (5′- CGCTCTTAATATCTCCTCTA-3′), and the TaqMan probe MDPV-qP (FAM-5′- TGAACGAGCGAATGAGCCTTCC-3′-Eclipse) were designed using Primer Premier Software version 5.0 (Premier Biosoft, Palo Alto, CA, USA). The length of amplicon was 118 base pairs (bp). Primers (MDPV-qF and MDPV-qR) and probe (MDPV-qP) were verified by Basic Local Alignment Search Tool (BLAST, https://blast.ncbi.nlm.nih.gov/Blast.cgi ) for specificity analysis, then these verified primers and probe were synthesized by a commercial company (TaKaRa, Dalian, China).
4
Validation of Fusion Transcripts by PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For PCR validation of fusion transcripts, gene-specific primers were designed using Primer Premier software version 5.0 (PREMIER Biosoft International, Palo Alto, CA, USA). All primers used for reverse transcription (RT)-PCR analysis are listed in Additional file 5 : Table S2. The PCR products were confirmed by Sanger sequencing to ensure the authenticity of the chimeric transcripts.
5
qPCR Analysis of miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. First-strand cDNA was reverse transcribed from the total RNA using the RevertAid First Strand cDNA synthesis kit (Thermo Fisher Scientific, Inc.). The temperature and time of the reaction were 85°C for 5 min, 4°C for 5 min. The qPCR assay was performed using SYBR-Green PCR Master Mix kit (Takara Biotechnology Co., Ltd., Dalian, China) and an ABI 7500 real-time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The following thermocycling conditions were used for the PCR: Initial denaturation at 95°C for 30 sec; 40 cycles of 95°C for 5 sec, 60°C for 34 sec. Primers for target genes and U6 (the internal loading control) were designed using the Primer Premier software version 5.0 (Premier Biosoft International, Palo Alto, CA, USA) and synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China). The following primer sequences were used for PCR: miR-205 forwad, 5′-TGGGCTGAGTCCCTCT-3′ and reverse, 5′-GAGGGACGGGTGATGGGCAGATTGG-3′; U6 forward, 5′-CTCGCTTCGGCAGCACA-3′ and reverse, 5′-AACGCTTCACGAATTTGCGT-3′ (reverse). Expression levels were normalized to U6, and relative expression values were calculated using the 2−∆∆Cq method (24 (link)).
6
PCMV DPOL Gene Primer Design
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After a bioinformatics analysis of the DPOL gene of PCMV, specific primers-pair and a TaqMan probe were designed using Primer Premier Software version 5.0 (Premier Biosoft, Palo Alto, CA, USA). Detailed information regarding the primers (qPCMV-F and qPCMV-R) and probe (qPCMV-P) were shown in Table 1 . The probe (qPCMV-P) was labeled with FAM and BHQ-1 at the 5′-terminal and 3′-terminal, respectively. The primers and probe were synthesized by a commercial company (Sangon Biotech, Shanghai, China).
7
Quantitative Gene Expression Analysis of CCBE1 in Lung Diseases
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissue samples isolated from patients with lung cancer or pulmonary bullae using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's instructions. Total RNA (2 µg) was reverse transcribed (20 µl reaction volume) into cDNA using a reverse transcription system, as previously described (13 (link)). The following primers, designed using the Primer Premier software version 5.0 (Premier Biosoft International, Palo Alto, CA, USA) and synthesized by Sangon Biotech Co., Ltd. (Shanghai, China) were employed: CCBE1 forward, 5′-CGACTAAATACCCGTGTCTGAAG-3′ and reverse, 5′-TCGGCACAAACGTCGTAATCT-3′; β-actin forward, 5′-GCTCGTCGTCGACAACGGCTC-3′ and reverse, 5′-CAAACATGATCTGGGTCACTTCTC-3′. Amplification was performed under the following conditions: Initial incubation at 95°C for 10 sec, followed by 40 cycles at 95°C for 5 sec and at 62°C for 45 sec, and extension at 72°C for 3 min. The 25-µ LlPCR reaction system included 1 µl temple, 2 µl primers, 2 µl dNTP, 0.5 µl RT/Platinum™ Taq Mix (Invitrogen; Thermo Fisher Scientific, Inc.) and distilled water. PCR products were detected by 2% agarose gel electrophoresis as previously described (13 (link)).
8
Quantitative RT-PCR Analysis of MMP-9 and CD44
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Trizol (Gibco BRL) according to the manufacturer’s instructions. After quantification, complementary DNA (cDNA) was synthesized from 2 μg of total RNA using a Takara RNA PCR kit (Takara Bio Inc., Dalian, China). Primers were designed by Primer Premier software version 5.0 (PREMIER Biosoft, Palo Alto, CA, USA) and synthesized by Sangon Biotech (Shanghai, China). The following sequences were selected: MMP-9, CGGACCAAGGATACAGTTTGTT (forward) + GCGGTACATAGGGTACATGAGC (reverse); CD44, GAAGATTTGGACAGGACAGGAC (forward) + CGTGTGTGGGTAATGAGAGGTA (reverse). PCR program: initial denaturation at 95°C for 5 min, 40 cycles of 94°C for 20 s and 61°C for 20 s for annealing extension. β-Actin was used as the control.
9
Amplification and Sequencing of the Mitochondrial cox2 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from each isolate was extracted by the phenol-chloroform method (Jacobs et al., 1997) . A complete cox2 gene fragment was amplified from each sample by PCR using forward (Ps, 5'-TGAGGTAAGTCGTAACAAGG-3') and reverse (Pa, 5'-ATCTACAGCACGAAAAGCC-3') primers. Both primers were designed based on a standard sheep strain (GenBank accession No. AF297617) using Primer Premier software version 5.0 (Premier Biosoft International, CA, USA). The PCR was conducted in a final volume of 20 μL, which contained 10 μL 2X Taq PCR Master Mixture (Tiangen, Beijing, China), 1 μL genomic DNA, 1 μL of each primer, and 8 μL ddH 2 O. The PCR program consisted of one cycle of primary denaturation (5 min at 95°C) followed by 39 cycles of denaturation (30 s at 94°C), annealing (45 s at 50°C), extension (45 s at 72°C), and a final extension (10 min at 72°C). Positive and negative (no DNA) controls were included with each PCR set. To assess the quality of the PCR amplicons, 8 μL of each PCR product were run on 1.0% (w/v) agarose gels. The PCR products were purified using a TIANgel Midi Purification Kit (Tiangen), and were then sequenced in two directions by the Invitrogen Trading (Shanghai) Co. Ltd. Reference sequences were retrieved from the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!