An qRT-PCR approach was employed to confirm the differential expression of key genes of interest identified by RNA-Seq in the Wyslmt strain. These qRT-PCR assays were performed using a 4S Red Plus Nucleic Acid Stain (A606695, Sangon Biotech, Shanghai, China) with the primers being listed in Table 1 . Briefly, control Wyslmt cells and cells cultured in the presence of Diquat (2,500 mg/L) were grown for 24 h at 28°C and 180 rpm. Total RNA was extracted from these cells using the same protocols employed prior to RNA-seq analyses. Random primers and Maxima Reverse Transcriptase (EP0743, Thermo Scientific, Shanghai, China) were then used to prepare cDNA, which was used as a template for qRT-PCR. Three biological replicates were analyzed per sample, and the 2–ΔΔCT method was used to assess relative gene expression (Cheng et al., 2018 (link)).
4s red plus nucleic acid stain
Manufactured by Sangon
Sourced in China
The 4S Red Plus Nucleic Acid Stain is a fluorescent dye used for the detection and quantification of nucleic acids, such as DNA and RNA, in various applications. The stain exhibits strong fluorescence upon binding to nucleic acids, allowing for sensitive and accurate analysis.
Automatically generated - may contain errors
Lab products found in correlation
Agarose, by Sangon (3 mentions)
Fetal bovine serum (fbs), by Sartorius (2 mentions)
Annexin 5 fitc apoptosis detection kit, by CoWin Biotech (2 mentions)
Hoechst 33342 solution, by Sangon (2 mentions)
N n n n tetramethylethylenediamine temed, by Sangon (2 mentions)
Chemdoc xrs, by Bio-Rad (1 mentions)
Dna loading buffer 6, by Sangon (1 mentions)
Myecl imager, by Thermo Fisher Scientific (1 mentions)
Ecl western blotting analysis system kit, by GE Healthcare (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Dulbecco s modified eagle s medium dmem, by Sartorius (1 mentions)
Streptozotocin (stz), by Merck Group (1 mentions)
Unlq 10 column trizol total rna isolation kit, by Sangon (1 mentions)
Acetonitrile, by CNW Technologies (1 mentions)
Formic acid, by CNW Technologies (1 mentions)
Methanol, by CNW Technologies (1 mentions)
Bovine serum albumin (bsa), by Merck Group (1 mentions)
Casein, by Merck Group (1 mentions)
Dntp mix, by Sangon (1 mentions)
Casein na, by Merck Group (1 mentions)
14 protocols using 4s red plus nucleic acid stain
1
qRT-PCR Validation of RNA-Seq Findings
2
Characterization of σ70-AsiA Interactions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Template strand DNA oligonucleotide (5′-CACGTTTATGTGATGGTTTATTTCTATTATAACCATATGGATTATTAAGCAAAGCTTCTTTTCG-3′, Sangon Biotech, Inc.) and non-template strand DNA oligonucleotide (5′-CGAAAAGAAGCTTTGCTTAATAATCCATATGGTTATAATAGAAATAAACCATCACATAAACGTG-3′, Sangon Biotech, Inc.) were annealed at a 1:1 ratio in 10 mM Tris-HCl, pH 7.9, 0.2 M NaCl and stored at −80°C. Electrophoretic mobility shift assays were performed in reaction mixtures containing (20 μl): 0.2 μM σ70, 0.4 μM AsiA or AsiA derivative, 0.1 μM E. coli RNAP core enzyme, 0.05 μM DNA scaffold, 0.1 μM MotA, 0.1 mg/ml heparin, 7 mM Tris-HCl (pH 7.9), 50 mM Tris-Ac (pH 7.9), 0.19 M KGlu, 5 mM MgAc2, 0.4 mM EDTA, 0.2 mM DTT, 0.125 mg/ml BSA, 50 mM potassium phosphate (pH 6.5), 0.14 M NaCl and 22% glycerol. σ70 was incubated with AsiA or AsiA derivative for 10 min at 37°C, incubated with core for 10 min at 37°C, incubated with MotA and DNA scaffold for 10 min at 37°C, and incubated with 0.1 mg/ml heparin for 1 min at 37°C. The reaction mixtures were applied to 5% polyacrylamide slab gels (29:1 acrylamide/bisacrylamide), electrophoresed in 90 mM Tris-borate, pH 8.0, and 0.2 mM EDTA, stained with 4S Red Plus Nucleic Acid Stain (Sangon Biotech, Inc.) according to the procedure of the manufacturer, and analyzed by ImageJ (https://imagej.nih.gov/ij/ ).
3
Sperm Mitochondrial DNA Integrity Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mitochondria of the sperms were extracted using the QIAamp® DNA Mini Kit. The mtDNA integrity was carried out following a previous study [46 (link)]. Briefly, long PCR amplification was applied to 8220 and 8140 bp out of the 16 kb mitochondrial genome. Primers of the mtDNA fragment are shown in Table 2 , and were designed and synthesized by Sangon (Sangon Co., LTD, Shanghai, China). The amplification conditions were as follows: 30 cycles of denaturing (98 °C for 30 s), annealing (55 °C for 15 s), and extension (68 °C for 9 min). The PCR products were examined by electrophoresis with 1% agarose gel, and visualized using 4S Red Plus Nucleic Acid Stain (Sangon Co., LTD, Shanghai, China).
4
Oligonucleotide Synthesis and Cell Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All oligonucleotides used in this work were synthesized and puri ed by Sangon Biotechnology Co., Ltd.
(Shanghai, China), and their sequences are listed in Additional les 1: Table S1. Fetal bovine serum (FBS) and Dulbecco's modi ed Eagle's (DMEM) medium were obtained from Biological Industries (Israel) and HyClone (USA), respectively. Lipofectamine 3000 was ordered from ThermoFisher scienti c (USA). Annexin V-FITC apoptosis detection kit was purchased from CoWin Biosciences (Beijing, China). Hoechst 33342 solution, 4S Red Plus Nucleic Acid Stain and N, N, N', N'-tetramethyl ethylenediamine (TEMED) were ordered from Sangon Biotechnology Co., Ltd. (Shanghai, China). All the reagents were of analytical grade and used without further puri cation.
(Shanghai, China), and their sequences are listed in Additional les 1: Table S1. Fetal bovine serum (FBS) and Dulbecco's modi ed Eagle's (DMEM) medium were obtained from Biological Industries (Israel) and HyClone (USA), respectively. Lipofectamine 3000 was ordered from ThermoFisher scienti c (USA). Annexin V-FITC apoptosis detection kit was purchased from CoWin Biosciences (Beijing, China). Hoechst 33342 solution, 4S Red Plus Nucleic Acid Stain and N, N, N', N'-tetramethyl ethylenediamine (TEMED) were ordered from Sangon Biotechnology Co., Ltd. (Shanghai, China). All the reagents were of analytical grade and used without further puri cation.
5
Polyacrylamide Gel Electrophoresis of CRISPR Complexes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the polyacrylamide gel experiment, lanes 1–4 from left to right were loaded with 500 nM G1-B-10 strand and 500 nM G1-SE+-T-19 strand, 750 nM LbaCas12a and 500 nM gRNA (lane 1); 500 nM G1-B-11 strand and 500 nM G1-SE+-T-20 strand (lane 2); 500 nM G1-B-11 strand and 500 nM G1-SE+-T-19 strand (lane 3); and 500 nM G1-B-10 strand and 500 nM G1-SE+-T-19 strand (lane 4). To a 200 μl PCR tube, the above mix, 7.5 μl NEBuffer2.1 (10×) and 4 mM Mg2+ were added and brought up to a total volume of 50 μl by deionized water. The reaction process was 1 h, followed by 95°C for 30 min, 55°C for 5 min and then 37°C for 10 min. Then, DNA loading buffer (6×) (Sangon Co., China) was added to the tube. A 15% denatured polyacrylamide gel was used to separate the DNA strands. Electrophoresis was carried out at 100 V for 2 h. The gel was then removed and soaked in the dye solution (4S Red Plus Nucleic Acid Stain, Sangon Co.) for 30 min. The gel image was taken by Bio-rad ChemDoc XRS (Bio-Rad, USA).
6
Phosphorylation and EMSA Assays for MtrA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To phosphorylate MtrA and its variants, the proteins were incubated with 50 mM acetyl phosphate for 30 min at 30°C in 50 mM Tris-Cl (pH 8.0) and 5 mM MgCl2 (38 (link)). The proteins were treated without acetyl phosphate in parallel as negative controls for use in electrophoretic mobility shift assays (EMSAs). Complementary biotin-labeled primers (Table 2 ) were annealed to generate the EMSA probes, and the reaction conditions were as described previously (22 (link)). In brief, the DNA probes and proteins were mixed, incubated, and separated by 8% nondenaturing polyacrylamide gels. The gels were transferred and fixed on nylon membranes. Then, the membranes were blocked, washed, and processed as recommended (21 (link)). Finally, signals were detected by using the ECL Western blotting analysis system kit (GE Healthcare) followed by exposure to X-ray film or displayed using the myECL imager (Thermo Scientific). For some EMSAs (Fig. 1 and 2 ), after gel electrophoresis, the gels were stained with 4S red plus nucleic acid stain (Sangon) and imaged with a UV imager.
7
Oligonucleotide Synthesis and Cell Culture Reagents
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All oligonucleotides used in this work were synthesized and purified by Sangon Biotechnology Co., Ltd. (Shanghai, China), and their sequences are listed in Additional file 1 : Table S1. Fetal bovine serum (FBS) and Dulbecco’s modified Eagle’s medium (DMEM) were obtained from Biological Industries (Israel) and HyClone (USA), respectively. Lipofectamine 3000 was ordered from ThermoFisher scientific (USA). Annexin V-FITC apoptosis detection kit was purchased from CoWin Biosciences (Beijing, China). Hoechst 33342 solution, 4 S Red Plus Nucleic Acid Stain and N,N,N′,N′-tetramethyl ethylenediamine (TEMED) were ordered from Sangon Biotechnology Co., Ltd. (Shanghai, China). All the reagents were of analytical grade and used without further purification.
8
Radioactive Transcription Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Electrophoretic mobility shift assays with the DNA scaffold for radioactive transcription assay were performed in reaction mixtures containing (50 μl): 0.1 μM 21Q, 0.1 μM E. coli RNAP-σ70 holoenzyme, 0.11 μM DNA scaffold, 50 mM Tris-HCl, pH 8.0, 0.1 M KCl, 10 mM MgCl2, 1 mM DTT, and 5% glycerol. Reaction mixtures were incubated 10 min at 37 °C, supplemented with 1 mM ATP, 1 mM UTP, and 1 mM GTP, and RNA synthesis was allowed to proceed for 10 min at 37 °C. Reaction mixtures were applied to 5% polyacrylamide slab gels (29:1 acrylamide/bisacrylamide), electrophoresed in 90 mM Tris-borate, pH 8.0, and 0.2 mM EDTA, stained with 4S Red Plus Nucleic Acid Stain (Sangon Biotech, Inc.) according to the procedure of the manufacturer, and analyzed by ImageJ (https://imagej.nih.gov/ij/ ).
9
RNA Polymerase Displacement Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Template strand DNA oligonucleotide and nontemplate strand DNA oligonucleotide (Sangon Biotech, Inc.) were annealed at a 1:1 ratio in 10 mM Tris–HCl, pH 7.9, 0.2 M NaCl and stored at −80°C.
T. thermophilus RNAP displacement assay was performed in reaction mixtures containing (20 μl): 2 μM RNAP holo enzyme, 0.1 μM DNA scaffold, 2 mM ATP, 0.2 mM UTP, 0.2 mM GTP, 50 mM Tris–HCl (pH 7.9), 0.1 M KCl, 10 mM MgCl2, 1 mM DTT and 5% glycerol. Reaction mixtures were incubated 10 min at 65°C, supplemented with 0.1 mg/ml heparin and 4 μM Mfd or Mfd derivative, incubated 10 min at 65°C.
E. coli RNAP displacement assay was performed in reaction mixtures containing (20 μl): 0.1 μM RNAP holo enzyme, 0.13 μM DNA scaffold, 2 mM ATP, 0.2 mM UTP, 0.2 mM GTP, 50 mM Tris–HCl (pH 7.9), 0.1 M KCl, 10 mM MgCl2, 1 mM DTT and 5% glycerol. Reaction mixtures were incubated 10 min at 37°C, supplemented with 0.1 mg/ml heparin and 1 μM Mfd or Mfd derivative, incubated 10 min at 37°C.
The reaction mixtures were applied to 5% polyacrylamide slab gels (29:1 acrylamide/bisacrylamide), electrophoresed in 90 mM Tris-borate, pH 8.0 and 0.2 mM EDTA, stained with 4S Red Plus Nucleic Acid Stain (Sangon Biotech, Inc.) according to the procedure of the manufacturer.
T. thermophilus RNAP displacement assay was performed in reaction mixtures containing (20 μl): 2 μM RNAP holo enzyme, 0.1 μM DNA scaffold, 2 mM ATP, 0.2 mM UTP, 0.2 mM GTP, 50 mM Tris–HCl (pH 7.9), 0.1 M KCl, 10 mM MgCl2, 1 mM DTT and 5% glycerol. Reaction mixtures were incubated 10 min at 65°C, supplemented with 0.1 mg/ml heparin and 4 μM Mfd or Mfd derivative, incubated 10 min at 65°C.
E. coli RNAP displacement assay was performed in reaction mixtures containing (20 μl): 0.1 μM RNAP holo enzyme, 0.13 μM DNA scaffold, 2 mM ATP, 0.2 mM UTP, 0.2 mM GTP, 50 mM Tris–HCl (pH 7.9), 0.1 M KCl, 10 mM MgCl2, 1 mM DTT and 5% glycerol. Reaction mixtures were incubated 10 min at 37°C, supplemented with 0.1 mg/ml heparin and 1 μM Mfd or Mfd derivative, incubated 10 min at 37°C.
The reaction mixtures were applied to 5% polyacrylamide slab gels (29:1 acrylamide/bisacrylamide), electrophoresed in 90 mM Tris-borate, pH 8.0 and 0.2 mM EDTA, stained with 4S Red Plus Nucleic Acid Stain (Sangon Biotech, Inc.) according to the procedure of the manufacturer.
10
Electrophoretic Mobility Shift Assay for SspA-σ70 Interaction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Template strand DNA oligonucleotide (5′-TCCCCTGCATCCGTGACAGCTCCCATTATAGC ACAATTTAACACTTTTGTCAATCATTTTGTT-3′, Sangon Biotech, Inc.) and non-template strand DNA oligonucleotide (5′- AACAAAATGATTGACAAAAGTGTTAAATTGTGCTAT AATGGGAGCTGTCACGGATGCAGGGGA-3′, Sangon Biotech, Inc.) were annealed at a 1:1 ratio in 10 mM Tris–HCl, pH 7.9, 0.2 M NaCl and stored at −80°C. Electrophoretic mobility shift assays were performed in reaction mixtures containing (20 μl): 0.4 μM wild type SspA or SspA mutant derivatives, 0.1 μM E. coli σ70-RNAPholoenzyme, 0.05 μM DNA scaffold, 0.1mg/ml heparin, 7 mM Tris–HCl (pH 7.9), 50 mM Tris–Ac (pH 7.9), 0.19 M KGlu, 5 mM MgAc2, 0.4 mM EDTA,0.2 mM DTT, 0.125 mg/ml BSA, 50 mM potassium phosphate (pH 6.5), 0.14 M NaCl and 22% glycerol. Wild type SspA protein incubated with E. coli σ70-RNAP holoenzyme for 10 min at 37°C, then incubated with DNA scaffold for 10 min at 37°C, and incubated with 0.1 mg/ml heparin for 1 min at 37°C. The reaction mixtures were applied to 5% polyacrylamide slab gels (29:1 acrylamide/bisacrylamide), electrophoresed in 90 mM Tris-borate, pH 8.0, and 0.2 mM EDTA, stained with 4S Red Plus Nucleic Acid Stain (Sangon Biotech, Inc.) according to the procedure of the manufacturer, and analyzed by ImageJ (https://imagej.nih.gov/ij/ ).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!