Hiseq x platform

Peripheral blood samples from the affected child and parents were obtained at the Athinoula A. Martinos Center for Biomedical Imaging, Massachusetts General Hospital for DNA extraction. DNA extraction and library preparation were performed using standard protocol and WGS was performed by Novogene Co. Ltd. (Durham, NC, USA) on HiSeq X platform.
A total amount of 1.0 μg DNA per sample was used as input material for the DNA sample preparations. Sequencing libraries were generated using NEBNext^® DNA Library Prep Kit (New England BioLabs, Ipswich, MA, USA) following the manufacturer’s recommendations and indices were added to each sample. The genomic DNA is randomly fragmented to a size of 350 bp by shearing, then DNA fragments were end-polished, A-tailed, and ligated with the NEBNext adapter for Illumina sequencing, and further PCR enriched by P5 and indexed P7 oligos. The PCR products were purified (AMPure XP system; Beckman Coulter, Indianapolis, IN, USA) and resulted libraries were analyzed for size distribution by Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) and quantified using real-time PCR.

Total RNA was extracted from samples of V. inaequalis isolate MNH120 grown in culture, as well as infected leaves, using a Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, St. Louis, MO, USA), with DNA subsequently removed using DNase I (Invitrogen^TM, Thermo Fisher Scientific, MA, USA). RNA concentration and purity were quantified using a Nanodrop ND-1000 Spectrophotometer (NanoDrop Technologies, Rockland, DE, USA), while RNA integrity was assessed on the Agilent 2100 Bioanalyser (Agilent Technologies, Waldbronn, Germany) using an Agilent RNA 6000 Nano Kit in conjunction with Agilent 2100 Bioanalyzer software. Genomic DNA contamination was excluded by visualization of RNA on a 0.8% agarose gel and absence of polymerase chain reaction (PCR) amplification products specific to the actin gene of apple (GenBank Accession OU745002.1 [location 20,713,063–20,714,807]; primers RE45 [5′–TGACCGAATGAGCAAGGAAATTACT–3′] and RE64 [5′–TACTCAGCTTTGGCAATCCACATC–3′]) [11 (link), 136 ]. Following these quality control checks, total RNA from each of the samples was sequenced on a HiSeq X platform at Novogene (Beijing, China) via the Massey Genome Service facility (Palmerston North, New Zealand; project number MGS00286). Here, only those RNA samples with an RNA Integrity Number (RIN) value of ≥3.5 were sequenced.

The fresh C. speciosa materials were collected from Houyi Garden of Southwest University, 2 Tiansheng Road, Beibei District, Chongqing (longitude 106.4242178°, latitude 29.8251892°, or 106°25’ 27.184” E, 29°49’ 30.681” N). Total genomic DNA was obtained using the cetyltrimethylammonium bromide (CTAB) method [39 (link)]. The DNA library (Illumina) was constructed with an insert size of 500 bp using the NEBNext^®® Ultra™ II DNA library Prep Kit (NEB, Beijing, China) [40 (link)]. The Hiseq X platform was used for short-read sequencing (Novogene, Tianjin, China) [41 (link)]. Purified DNA was prepared for long-read sequencing with the SQK-LSK108 genomic sequencing kit (Oxford, UK). The purified library was loaded into an R9.4 Spot-On Flow for nanopore sequencing.