RNA samples isolated from root and shoot tissues showing A260/280 between 1.8–2.0 and A260/230 > 2.0 were used for cDNA synthesis. First-strand cDNA was synthesized by using an equal amount (0.5 μg) of total RNA as the template and 2.0 μmol oligo-dT primer in a 20 μL reaction volume at 37°C for 1 h by using the Revert Aid Premium first-strand cDNA synthesis kit (Fermentas), as per the manufacturer's instructions, by using a Triple Master PCR system (Eppendorf). The first-strand cDNA (2.0 μL) was used for expression analysis of TaHKT1;4 gene by using the gene-specific primers. PCR conditions were as previously mentioned, and the number of PCR cycles for semi-quantitative analysis was optimized by assessing the amplification products after 20, 24, 28, 32, and 36 cycles on 1.5% agarose gel. Actin and Ferredoxin-NADP(H) oxidoreductase were used as reference genes. To ensure the reproducibility of the results, the experiment was repeated three times.
Triplemasterpcr system
Manufactured by Eppendorf
Sourced in Germany
The TripleMasterPCR System is a versatile laboratory equipment designed for polymerase chain reaction (PCR) amplification. It provides precise temperature control and automated cycling to facilitate DNA and RNA amplification. The system is capable of running multiple samples simultaneously to support various genomic research and molecular biology applications.
Automatically generated - may contain errors
Lab products found in correlation
4 protocols using triplemasterpcr system
1
TaHKT1;4 Gene Expression Analysis
2
Tracking Mitochondria in Diatom Mutant
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The T. pseudonana mutant line Tig19 (Schober et�al. 2018 ) expresses GFP fused to the pre-sequence of mitochondrial triosephosphate isomerase/glyceraldehyde-3-phosphate dehydrogenase (preTPI-GAPDH::GFP) and thus promotes fluorescence microscopic tracking of mitochondria during organelle isolation. Initial parts of the TPI-GAPDH pre-sequence (short: TIG; JGI Protein ID: 28239) were amplified from T. pseudonana cDNA using the TripleMaster PCR System (Eppendorf; Hamburg, Germany) with the oligonucleotides TIG28239_fw: TAGGTACCAAGATGTTATCAAACACTG and TIG28239_rev: AAGGTACCGTTGCATTTCCAGTTTC. The resulting 142 bp PCR fragment was subcloned into the pGEM-T cloning Vector (#A1360, Promega; Mannheim, Germany). Digestion of both flanking KpnI restriction sites allowed cloning into the T. pseudonana GFP expression vector pTpFcpGFP Vector (Poulsen et�al. 2006 ). Correct insertion was verified by Sanger sequencing (GATC; Konstanz, Germany) and resulting vector was co-transformed together with the selection plasmid pTpfcpNAT into T. pseudonana wild type strain CCMP 1335 [National Center for Marine Algae and Microbiota (NCMA); Maine, USA] as described by Poulsen et�al. (2006) . Cell line number 19 (TIG19) was used for further experiments.
3
Determining Chromosomal Deletions by PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The definition of breakpoint sequences was analyzed by long-range gap-PCR using a TripleMasterPCR System (Eppendorf, Hamburg, Germany) with primers shown in Table S2 . The UCSC browser was used for the representation of the deletions on chromosome 16 [31 (link),32 (link)].
4
Screening for Italian (εγδβ)0-Thalassemia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genomic DNA encompassing the deletion breakpoint was amplified by long-range gap-PCR using the TripleMasterPCR System (Eppendorf, Hamburg, Germany) with the forward primers p 5 ′ -GCATC TAGGTTAGGGAATTAGCCA-3 ′ and the reverse primer c 5 ′ -TCAATGTGATCAAGATTTGGGAG TT-3 ′ , giving rise to a fragment of about 6.5 kb. The region of the breakpoint was reduced by restriction mapping analysis using the enzymes BglII, HindIII, and SacI; new primers were designed (forward primer p1 5 ′ -AGATGTCTATTAGGTCCGCTTGG T-3 ′ and reverse primer c1 5 ′ -CAACTGCTGTG TTCTTTTGTTCAGA-3 ′ ) and a new fragment of about 1.7 kb was amplified by long-range gap-PCR and then sequenced (Figs. 1B and2A). 14 A gap-PCR for the screening of carriers for the Italian (εγδβ) 0 -thalassemia was set up. The specific deletion amplicon was 1.750 bp ( primers c1 and p1); the internal control amplicon was 866 bp (forward primers control A 5 ′ -TCAAATGTATCATGCCT CTTTGCACC-3 ′ and reverse primer control B 5 ′ -T GGAGTCAAGGCTGAGAAGATGCAGGA-3 ′ ) (Fig. 2B).
Note: Primer positions are according to Reference Sequence GRCh37/hg19 (http://genome.ucsc.edu). B2M: β2 microglobulin.
Note: Primer positions are according to Reference Sequence GRCh37/hg19 (http://genome.ucsc.edu). B2M: β2 microglobulin.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!