Favorprep stool dna isolation mini kit

Genomic DNA from fecal and cecal content samples were isolated using the FavorPrep Stool DNA Isolation Mini Kit (FAVORGEN Biotech Corp., Ping-Tung, Taiwan) in accordance with the manufacturer’s protocol. The relative abundance of each target’s bacterial 16S rRNA gene sequence (see primer sequences in Table 1) was calculated by normalization to the amount of amplified product from all bacteria 16S rRNA gene copy numbers.

Healthy individuals and individuals diagnosed with CRC underwent colonoscopy procedures administered by gastroenterologists. CRC cases identified as positive during the initial screening were subsequently confirmed through histopathology tests. A total of 50 fecal samples, comprising 25 CRC patients and 25 healthy subjects, were meticulously selected. Inclusion and exclusion criteria were applied based on specific medical histories and medication usage. These fecal samples were carefully collected and then preserved at − 80 °C. Standard strains of Lactobacillus acidophilus were cultured. Genomic DNA was extracted from fecal specimens using the FavorPrep Stool DNA Isolation Mini Kit, produced by Favorgen in Taiwan, and the standard strain method, which involved phenol–chloroform extraction. The quantification of bacterial expression copy numbers per gram of feces was determined using Absolute RT-qPCR, relying on standard curves, with specific primers detailed in Table 1.Table 1

Primer sequences.

Primer	Sequence
SFRP1	F: CTTCTACTGGCCCGAGATGCT
	R: ATGGCCTCAGATTTCAACTCGT
SFRP2	F: AGCCCGACTTCTCCTACAAGC
	R: CTTCATGACCAGCGGGATCCA
SFRP4	F: ACAAATTCTTCTTGCCAGTGTC
	R: GCCTCTCTTCCCACTGTATG
MMP7	F: GAATGTTAAACTCCCGCGTC
	R: CGATCCACTGTAATATGCGGTA
GAPDH	F: GTGATGCTGGTGCTGA
	R: GCTAAGCAGTTGGTGG
L. acidophilus	F: AATTCTCTTCTCGGTCGCTCTA
	R: CCTTTCTAA GGAAGCGAAGGAT

Soft tissue samples were extracted with either the QIAamp® DNA Mini Kit or QIAcube HT kits (QIAGEN, Inc.) using the manufacturer’s protocol, or the PrepMan Ultra reagent. DNA extraction from soft tissue samples using PrepMan was performed by wiping tissue surfaces for 30 s with a sterile cotton swab. The swab was then added to 150 μl of PrepMan Ultra reagent, vortexed for 15 s, and incubated for 5 min at 95 °C. PCR inhibitors were removed by adding the PrepMan/sample lysate to a column using the OneStep™ PCR Inhibitor Removal Kit (Zymo Research) per manufacturer’s protocol. FFPE samples were extracted using a modified FFPE extraction protocol from the QIAamp DNA Mini and Blood Mini Handbook (see supplementary information for details). Blood sample extraction was performed using the QIAcube HT kit. Fecal samples were extracted with the QIAamp® DNA Stool Mini Kit (QIAGEN, Inc.) or the PrepMan rapid-extraction protocol. DNA was extracted from fecal samples using PrepMan by adding 100 mg of feces to 150 μl of PrepMan Ultra reagent and diluted 1:10 with nuclease free water after the PCR inhibition removal step. Mock tiger bone wine DNA extraction was performed using a modified FavorPrep Stool DNA Isolation Mini Kit protocol (FAVORGEN Biotech Corp.) (the bead beating step was not performed; see supplementary information for protocol details).

DNA extraction was carried out using FavorPrep Stool DNA Isolation Mini Kit (Favorgen Biotech Corp., Taiwan), according to manufacturer instructions. DNA extraction was checked by 0.7% agarose gel electrophoresis and DNA concentration was measured using NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific, USA). Samples were standardized at the same DNA concentration (10 ng/µL) and then stored at −20 °C until DNA amplification.

DNA was extracted from each fecal sample using FavorPrep™ Stool DNA Isolation Mini Kit (Favorgen, Taiwan, Cat No. FASTI 001-1) according to the manufacturer protocol. Then after, the extracted DNA was stored at −20 °C till further molecular analysis.

Genomic DNA from fecal and cecal content samples was isolated using a Favorprep Stool DNA Isolation Mini Kit (FAVORGEN Biotech Corp., Ping-Tung, Taiwan) according to the manufacturer’s protocol. The relative abundance of each target bacterial 16S rRNA gene copy (primer sequences are shown in Supplemental Table S1) was calculated by normalizing relative to the amount of amplified product from all bacteria 16S rRNA gene copies.

Intestinal pieces from the foregut and hindgut of gilthead seabream juveniles were dissected using a sterile scalpel, and approximately 100 mg of gut was crushed using a FastPrep FP120 cell disrupter (BIO 101, Thermo Savant, Irvine, CA, USA). DNA extraction was carried out using FavorPrep™ Stool DNA Isolation Mini Kit (Favorgen Biotech Corp., Taipei, Taiwan) according to the manufacturer’s instructions. DNA extraction was checked with 0.7% agarose gel electrophoresis, and DNA concentration was measured using NanoDrop™ 2000 Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Samples were stored at −20 °C until DNA amplification.