SYBR green fluorescence was used to quantify fragments of transcripts of interest, using the following primers: GLS-Forward (5′ GGAAGCCTGCAAAGTAAACCC 3′), GLS-Reverse (5′ CCAAAGTGCAGTGCTTCATCC 3′) or SdhB-Forward (5′ ACTCTAGCTTGCACCCGAAG 3′) and SdhB-Reverse (5′ GCTGCTTGCCTTCCTGAGAT 3′). A fragment of the transcript encoding histone gene HIST1H1C was amplified alongside the investigated genes as an internal control, using the following primers: Forward (5’ GCGGCGCAACTCCGAAGAAG 3’) and Reverse (5’ AGCGGCCTTGGGCTTCACAG 3’).
The reaction mixture was prepared according to manufacturer instructions (iTaq Universal One-Step Kit, Bio-Rad, Hercules, CA, USA), primers at a concentration of 500 nM, and sample RNA constituting 1/10 of the reaction mixture. Negative control wells with no sample were included to confirm that no contamination was present. The CFX Connect Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) was used to amplify and detect the transcript fragments of interest. The cycle threshold obtained for the target transcript fragments of interest was subtracted from that of HIST1H1C to assess relative quantification.
The reaction mixture was prepared according to manufacturer instructions (iTaq Universal One-Step Kit, Bio-Rad, Hercules, CA, USA), primers at a concentration of 500 nM, and sample RNA constituting 1/10 of the reaction mixture. Negative control wells with no sample were included to confirm that no contamination was present. The CFX Connect Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) was used to amplify and detect the transcript fragments of interest. The cycle threshold obtained for the target transcript fragments of interest was subtracted from that of HIST1H1C to assess relative quantification.