Pdest17

All aglycones or conjugated flavones or isoflavone substrates were bought from Dalian Meilun Biological Technology Co. Ltd. (Dalian, Liaoning Province, China). Whereas, malonyl-CoA was purchased from Sigma-Aldrich, St. Louis, MO, United States. The vector pGEM-T easy was purchased from Promega (Madison, WI, United States); the gateway vectors pDONR221, pDEST17, pB2GW7, pB7GWIWGII, and pK7WGF2 were either purchased from Invitrogen (Rockville, MD, United States), or gifts from Dr. Richard Dixon’s Lab at the Noble Foundation, OK, United States.

Me47 coding sequence lacking the secretion signal was amplified from 100 ng of potato aphid cDNA using primers attB1 Me47-F and attB2 Me47-R (Supplementary Table S1) and high-fidelity Phusion polymerase (New England Biolabs) with the following thermocycle (30 s at 95°C, 30 s at 55°C, 30 s at 72°C × 30 cycles). The attB-flanked Me47 PCR product was recombined into pDONRzeo using BP clonase (Invitrogen) following the manufacturer’s instructions. Me47 was sequence verified by Sanger sequencing before subsequent shuttling into the destination vectors pEARLEYGATE100 for in planta Agroexpression (Earley et al., 2006 (link)), pVSP_PsSPdes for bacterial delivery in tomato and Arabidopsis (Arabidopsis thaliana; Rentel et al., 2008 (link)) and pDEST17 (Invitrogen) for recombinant protein expression using LR clonase (Invitrogen). For initial cloning, electrocompetent DH5α cells were used for all transformations and Agrobacterium strain GV3101 was used for Agroexpression following standard procedures

Open reading frames LIC10009 (encoding a protein designated Lp25, for leptospiral protein 25, based on its molecular mass) [21 (link)] and LIC11352 (LipL32) were cloned into pAE [17 (link),22 ] and pDEST-17 (Invitrogen, Carlsbad, CA, USA -or- Paisley, Scotland, UK.) vectors, respectively, as previously described [23 (link)]. The coding sequence of the carboxy-terminal portion of LigA (LigAC), corresponding to nucleotides 1891–3675 (LIC10465), was cloned into a pAE vector as previously described [21 (link)]. The coding sequence of the LipL31 (LIC11456) was amplified using PCR from genomic DNA of L. interrogans serovar Copenhageni strain Fiocruz L1-130 using the following primers: F: CTCGAGGGAGATAATTCCG and R: CTGCAGTTACTGCCCAGTAG. Sequences were digested using XhoI and HindIII restriction enzymes, and fragments were cloned into the pAE vector [22 ]. Competent cells of the E.coli BL21(DE3) strain were transformed with pAE-Lp25, pAE-LigAC, pDEST-LipL32, and pAE-LipL31 constructs and cultivated until the optical density at 600 nm reached 0.6. The expression of recombinant proteins was induced with 1 mM isopropyl-1-thio-β-D-galactopyranoside (IPTG) at 37°C for 3 h. The His-tagged Lp25, LipL32, LigAC, and LipL31 proteins were purified using metal affinity chromatography, as previously described [21 (link)].

A. salmonicida strain LFI1238 (NCBI Taxonomy ID 316275) was obtained from the Norwegian Institute of Fisheries and Aquaculture Research culture collection, Tromsø, Norway. Genomic DNA was extracted using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA), following the manufacturers’ instructions. Chemically competent Top 10 cells, pDONR221, pDEST14, pDEST17 and E. coli One Shot BL21 Star DE3 strain were from Invitrogen-Life Technologies (Carlsbad, CA, USA). The genome of the host strain does not contain a gene encoding NAL.

We amplified corresponding genes lacking the N-terminal transpeptide regions and constructed them into the expression vectors pDEST15 and pDEST17 (Invitrogen). The expression vectors pDEST15 and pDEST17 were introduced into the Escherichia coli Rosetta and BL21 strain, respectively. These proteins were expressed under 25°C conditions, and pull-down experiments were performed with proteins using a GST affinity column with PBS buffer (pH 7.4). The beads were washed with PBS buffer (pH 7.4), 0.5% Triton X-100, and 0.5 mM PMSF. Bound proteins were eluted and subjected to SDS-PAGE followed by Western blot analysis with the antibody against His tag. We performed three independent biological replicates.

Partial Atg16 coding sequences were amplified using primers ATGTCTACGGAGGAGCATGTGTG and ATCTTATTAGGGCTCACGAACCGCGTC (for recombinant Atg16 domain expression), or GGATCCGCATATGAGAAAAAGACTGCCGTCAATTTTCA and GTCGACTCGAGTTAATTTTTGCCAATGTCCCAAAGTT (for recombinant Atg16 linker region expression). The PCR products were phosphorylated, blunt cloned into XmnI–EcoRV-digested dephosphorylated pENTR1A (Invitrogen), and subsequently recombined into pDEST17 (Invitrogen). N-terminally His-tagged protein was expressed in the Escherichia coli Rosetta strain (EMD Millipore) and purified using Ni-agarose beads (Qiagen/Biomarker). Recombinant proteins were used to immunize rats in-house following standard procedures utilizing Freund’s adjuvants (Sigma).