Kingfisher flex 96 well extraction machine

For RT–qPCR, mouse tissues were weighed and homogenized with zirconia beads in a MagNA Lyser instrument (Roche Life Science) in 1 mL of DMEM medium supplemented with 2% heat-inactivated FBS. Tissue homogenates were clarified by centrifugation at 10,000 rpm for 5 min and stored at −80°C. RNA was extracted using a MagMax mirVana Total RNA isolation kit (Thermo Fisher Scientific) and a Kingfisher Flex 96-well extraction machine (Thermo Fisher Scientific). RNA was reverse transcribed and amplified using the TaqMan RNA-to-CT 1-Step Kit (ThermoFisher). RNA levels were measured by one-step quantitative reverse transcriptase PCR (qRT-PCR) assay as previously described (Hassan et al., 2020 (link)). A TaqMan assay was designed to target the N gene, as previously described (Case; PMID 32838945). Specific primers and probe were used: Forward primer: ATGCTGCAATCGTGCTACAA; Reverse primer: GACTGCCGCCTCTGCTC; Probe: /56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/. N gene copy numbers were determined down to 10 copies per reaction.

SARS-CoV-2 was incubated with mAbs at 10 μg/mL for 1 h at 4°C. The mixture then was added to pre-chilled Vero E6, Vero-TMPRSS2, Vero-TMPRSS2-ACE2, or Calu-3 cells at an MOI of 0.005 and incubated at 4°C for 1 h. Cells were washed six times with chilled PBS before addition of lysis buffer and extraction of RNA using MagMax viral RNA isolation kit (Thermo Fisher Scientific) and a Kingfisher Flex 96-well extraction machine (Thermo Fisher Scientific). SARS-CoV-2 RNA was quantified by qRT-PCR using the N-specific primer/probe set described below. GAPDH was measured using a predesigned primer/probe set (IDT PrimeTime Assay Hs.PT.39a.22214836). Viral RNA levels were normalized to GAPDH, and the fold change was compared with isotype control mAb. For each cell type, a control with a 4-fold lower MOI (0.00125) was included to demonstrate detection of decreased viral RNA levels.