Exosome rna isolation kit

Total RNA from cartilage tissues, FLSs, and chondrocytes was isolated with RNA Purification Kit (Takara, China). The RNA of FLS exosomes was extracted using an Exosome RNA Isolation Kit (Invitrogen, USA). The RT-qPCR was performed using Reverse Transcription Kit (Takara, China) and qPCR Mix (Takara, China) according to the kit’s instructions. The miR-19b-3p and SLC7A11 expression was assessed using the 2^-ΔΔCt method and normalized to U6 or β-actin. The primer sequences used in the study were as follows (5’–3’): miR-19b-3p (forward, TCTACAGGTGTGCAAATCCATG; reverse, TGTCGTGGAGTCGGCAATTC); U6 (forward, CGCTTCGGCAGCACATATACTA; reverse, ATGGAACGCTTCACGAATTTGC); SLC7A11 (forward, TGCTGGGCTGATTTTATCTTCG; reverse, GAAAGGGCAACCATGAAGAGG); β-actin (forward, TGGTATCGTGGAAGGACTC; reverse, AGTAGAGGCAGGGATGATG).

Fresh frozen peri-ischemic striatum was dissected and treated with 20 units/ml papain (Worthington) in Hibernate E solution (2 ml/sample, BrainBits, Springfield, IL) for 15 min at 37°C. The tissue gently homogenized in 2 volumes (5 ml/sample) of cold Hibernate E solution. The tissue homogenate sequentially filtered through a 40 m mesh filter (BD Biosciences) and a 0.2 m syringe filter (Thermo Scientific). Exosomes were isolated from the filtrate as previously literature (Perez-Gonzalez et al., 2012 (link)). The filtrate was sequentially centrifuged at 300 g for 10 min at 4°C, 2,000 g for 10 min at 4°C, and 10,000 g for 30 min at 4°C to discard cells, membranes, and debris. Then, the exosomes were extracted according to the Exosome Isolation Kit (UR52121, Umibio, Shanghai, China). The total exosome RNA was isolated by the Exosome RNA isolation kit (Invitrogen), and microRNA expression profiling analyzed by the miRCURY LNA^TM microRNA array system (Exiqon).