Total RNA was isolated from 8-week-old mice testes using the RNAsimple (Tiangen, DP419) according to the manufacturer's protocol. cDNA synthesis was performed using PrimeScript™ RT reagent Kit (Takara RR037A), Primer sequence is shown in Table 2 .
Rnasimple
Manufactured by Tiangen Biotech
Sourced in China
RNAsimple is a lab equipment product from Tiangen Biotech designed for the extraction and purification of RNA samples. It provides a simple and efficient method for isolating high-quality RNA from various biological samples.
Automatically generated - may contain errors
Lab products found in correlation
3 protocols using rnasimple
1
Total RNA Isolation and cDNA Synthesis
2
Quantification of circRbms1 and target genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNAsimple (Tiangen, Beijing, China) was used to isolate total RNA from heart tissues and H9c2 cells. Using the Transcriptor First Strand cDNA Synthesis Kit (Roche, Basel, Switzerland), the RNA was reverse transcribed into cDNA. The RT procedure was 37 ℃ for 15 min and 85 ℃ for 5 s. After that, SYBR Green PCR Kit (Takara, Dalian, China) was used for qRT-PCR in a PCR system. The amplification process was as follows: denaturation at 95 ℃ for 5 min, followed by 40 cycles at 95 ℃ for 15 s, annealing at 55 ℃ for 30 s, and extension at 60 ℃ for 60 s. GAPDH or U6 was used as the internal control. Data were analyzed using the 2−ΔΔCt method. The primer sequences were as follows: circRbms1, F 5′-CTGAGCCTGGACTCCATTCG-3′, R 5′-ACCAGGAGTTTCTGGTTATGGT-3′; Rbms1, F 5′-CTGAGCAAGACAAACCTCTACAT-3′, R 5′-GGCCTTATCCAAAATCGCCTT-3′; miR-742-3p, F 5′-GCCGAGGAAAGCCACCATGCTGG-3′, R 5′-CAGTGCGTGTCGTGGAGT-3′; FOXO1, F 5′-CCCAGGCCGGAGTTTAACC-3′, R 5′-GTTGCTCATAAAGTCGGTGCT-3′; GAPDH, F 5′-GGTGAAGGTCGGTGTGAACG-3′, R 5′-CTCGCTCCTGGAAGATGGTG-3′; U6, F 5′-CTCGCTTCGGCAGCACATATACT-3′, R 5′-ACGCTTCACGAATTTGCGTGTC-3′.
3
Quantitative Analysis of circRNA, mRNA and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using RNA simple (Tiangen, Beijing, China), and cDNA was synthesized with First Strand cDNA Synthesis Kit (Beyotime, Shanghai, China) or TaqMan Advanced miRNA cDNA Synthesis Kit (ABI, Foster City, CA, USA). PCR operation was performed using SYBR Premix Kit (Takara, Dalian, China). Relative expression was analyzed with 2−ΔΔCT method with normalization to GAPDH or U6. Primer sequences were shown in Table 1 .
The Primer Sequences Used for qRT-PCR
| Gene | Forward Sequence (5ʹ-3ʹ) | Reverse Sequence (5ʹ-3ʹ) |
|---|---|---|
| circANTXR1 | TTTGAAGAAGTCCTGCATCG | AGAGCCTGAAAGCCGTCAT |
| ANTXR1 | ACAGTTGGCTCACAAATTCATCA | TCACTGGCCCTTTCAAATCCT |
| miR-3681-5p | TCGGCAGGTAGTCCATGATGCACT | CTCAACTGGTGTCGTGGA |
| miR-532-5p | GGGCATGCCTTGAGTGTAG | CAGTGCGTGTCGTGGAGT |
| XRCC5 | GTGCGGTCGGGGAATAAGG | GGGGATTCTATACCAGGAATGGA |
| GAPDH | AGCCACATCGCTCAGACAC | GCCCAATACGACCAAATCC |
| U6 | CTCGCTTCGGCAGCACA | AACGCTTCACGAATTTGCGT |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!