Trizol kit

The total RNA of “Yuhong” leaves was extracted using a Trizol kit (Tiangen Biotech Co., LTD., Beijing, China), and the quality was checked by an ultraviolet spectrophotometer and 1.5% agarose gel electrophoresis. The pair-end complementary DNA (cDNA) library was constructed and then sequenced using Illumina HiSeq2500 (Biomac Biotechnology Co., Ltd., Beijing, China), with an insert size of 250 bp based on sequencing by synthesis (SBS) technology to generate the raw data. Trimmomatic v0.39 (Bolger et al., 2014 (link)) and Perl script were used for quality control of the raw data, including the truncation of adapters and primer sequences and filtration of low-quality reads to obtain high-quality clean reads. Due to the lack of reference genomes, Trinity v2.1.1 (Grabherr et al., 2011 (link)) was used for parameter-free assembly to obtain the transcripts. The redundant transcripts (similarity >90% and overlap length > 35 bp) were integrated and clustered using cd-hit v4.8.1 (Fu et al., 2012 (link)). Among the different isoforms of the same gene, the longest was selected as a unigene. Finally, the clean data of each sample were mapped back against the assembled UniGene database to assess assembly quality.

Wheat genomic DNA (gDNA) was isolated from the primary leaves (collected as described above) using CTAB as described by Gao et al.^{53 (link)}. Gel electrophoresis was performed to check the gDNA quality and quantity using a known amount of lambda DNA as a standard. Only gDNA samples without degradation were used as templates for full-length ARG gene isolation and southern blotting analysis. Total RNA was extracted using the TRIzol Kit (TianGen Biotech (Beijing) Co., Ltd.) and reverse transcribed to cDNA using a PrimeScript^TM 1st Strand cDNA Synthesis Kit according to the manufacturer’s instructions (Dalian, China). The cDNA was stored at − 20 °C until further analysis.

Blood samples of Alligator sinensis were collected from the Beijing Zoo. Genomic DNA was extracted from the blood following the standard protocol. Total RNA was extracted from the blood using a TRIzol kit (TIANGEN BIOTECH, Beijing) following the manufacturer’s instructions. Our studies were approved by the Animal Care and Use Committee of the China Agricultural University.

Genomic DNA was isolated from leaves of seedlings with the cetytrimethylammonium
bromide (CTAB) procedure as reported by Murray and
Thompson (1980). Total RNA in various tissues was extracted according to
the manual of the TRIZOL Kit (TIANGEN, Beijing). The qualities and quantities of
extracted nucleotide were measured by NanoDrop 2000 (Thermo Fisher, USA).

Used Trizol kit (TIANGEN BIOTECH CO., LTD.) to extract total RNA from tubers of pigmented potatoes in different growth periods. Use Evo M-MLV reverse transcription premixed kit (including gDNA removal reagent for qPCR) Ver 2 (Accurate Biology), used SYBR ^® Green Pro Taq HS premixed qPCR kit (including ROX) (Accurate Biology) conducts real-time fluorescent quantitative PCR reaction. StGAPDH was the reference gene. The cDNA obtained by reverse transcription was diluted 10 times and used as a template. The primers of all genes (Table 1) were designed with SnapGene 4.3.6 software and synthesized by Sangon Biotech (Shanghai) Co., Ltd. All primers were diluted 10 times before being used. Reaction procedure: 95 °C 2 min, 95 °C 15 sec, 60 °C 30 sec, 40 cycles, Melt Curve Stage, 2^{- ΔΔ Ct} method (Livak and Schmittgen, 2001 (link)).

According to the manufacturer’s instructions, TRIzol kit (Tiangen Biotech (Beijing, China) Co., Ltd.) was used to separate total RNA from glioma cells. Thereafter, UEIris RT-qPCR System for First-Strand cDNA Synthesis (with Dnase I) (YuhengBio Suzhou, China) and miRNA First-Strand cDNA Synthesis were used. Tail Addition Kit (Sangon Biotech Shanghai, China) was applied to reversely transcribe the RNA into cDNA, and SYBR 2* qPCR Master Mix-qPCR was used to perform PCR (YuhengBio) with glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) adopted for endogenous control. Comparative quantification was detected using the 2^−ΔΔCt method. The sequences of the primers were as follows: GAPDH forward, 5′-AATGGTGAAGGTCGGTGTGA-3′; GAPDH reverse, 5′-CGTGAGTGGAGTCATACTGGAA-3′; TNF-α forward, 5′-CTCATTCCTGCTTGTGGC-3′; TNF-α reverse, 5′-TGTGAGTGTGAGGGTCTGG-3′; iNOS forward, 5′-CCTGCTTTGTGCGAAGTGTC-3′; iNOS reverse, 5′-CCCAAACACCAAGCTCATGC-3′; IL-6 forward, 5′-TCGTGGAAATGAGAAAAG-3′; IL-6 reverse, 5′-CTCTGAAGGACTCTGGCT-3′; IL-1β forward, 5′-CTTCAGGCAGGCAGTATC-3′; IL-1β reverse, 5′-GCTTTTTTGTTGTTCATCTC-3′; has-miR-93-5p, CAAAGUGCUGUUCGUGCAGGUAG; Universal primer, 5′-GCGAGCACAGAATTAATACGAC-3′. The PCR was set at the initial denaturation of 5 min at 95°C, following with 5 s at 95°C, 20 s at 72°C in a total of 40 cycles, and finally, 30 s at 95°C, 20 s at 58°C, and 30 s at 95°C.