μmacs streptavidin kit

Manufactured by Miltenyi Biotec

Sourced in United States, Germany

The μMacs Streptavidin Kit is a magnetic separation system that allows for the isolation and purification of biotinylated molecules or cells from complex samples. The kit utilizes streptavidin-coated magnetic beads to capture and separate the target analytes.

Automatically generated - may contain errors

Lab products found in correlation

16 protocols using μmacs streptavidin kit

Isolation and Purification of Thiolated RNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Thiolated RNAs were protected from light at all times. The isolation and purification protocols have been described previously (Gay et al., 2014 (link)). Briefly, tissues or ^PBsEV were homogenized in 1 ml TRIzol (Thermo Fisher Scientific) with a TissueRuptor (Qiagen, Germantown, MD, USA) and extracted with 200 μl chloroform; then, total RNA was precipitated from the aqueous phase via the addition of glycogen, Dithiothreitol (DTT), and 0.5 ml cold isopropanol, followed by centrifugation at 12,000 g and 4°C for 10 min. The RNA‐containing pellets were rinsed with 75% ethanol and centrifuged at 12,000 g and 4°C for 5 min; then, the supernatant was removed, the pellet was dissolved in RNase‐free water, and RNA concentration and purity were determined via Nanodrop (Thermo Fisher Scientific).
Ribosomal RNAs (rRNAs) were removed with a RiboMinus Transcriptome Isolation Kit (Thermo Fisher Scientific); then, the rRNA‐free RNAs were reacted with EZ‐Link biotin‐HDPD (Thermo Fisher Scientific), purified with an RNeasy minikit, and eluted in 20 μl of RNase‐free water. Biotinylated RNAs were isolated with a μMacs streptavidin kit (Miltenyi Biotec, Waltham, MA, USA) as directed by the manufacturer's instructions, but with 2‐mercaptoethanol (100 mM) rather than DTT used for the elution step, and then purified via ethanol precipitation.

Han C., Yang J., Zhang E., Jiang Y., Qiao A., Du Y., Zhang Q., An J., Sun J., Wang M., Nguyen T., Lal H., Krishnamurthy P., Zhang J, & Qin G. (2022). Metabolic labeling of cardiomyocyte‐derived small extracellular‐vesicle (sEV) miRNAs identifies miR‐208a in cardiac regulation of lung gene expression. Journal of Extracellular Vesicles, 11(10), 12246.

+ Open protocol

+ Expand

Metabolic Labeling and Purification of Newly Transcribed RNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Metabolic labeling was performed as previously described44 (link),45 (link). Briefly, cells were treated with 200 µM 4-thiouridine (4sU, Sigma) for 1 hour followed by phenol-chloroform RNA extraction. 80 µg of RNA was incubated with biotin-HPDP (Thermo) to specifically biotinylate the newly transcribed 4sU labeled RNAs. Biotinylated RNAs were then pulled down using the μMacs Streptavidin Kit (Miltenyi) and at least 100 ng of pulled RNA was used for reverse transcription and downstream qPCR analysis. This experiment was performed once with two biological replicates.

El-Brolosy M.A., Kontarakis Z., Rossi A., Kuenne C., Günther S., Fukuda N., Kikhi K., Boezio G.L., Takacs C., Lai S.L., Fukuda R., Gerri C., Giraldez A.J, & Stainier D.Y. (2019). Genetic compensation triggered by mutant mRNA degradation. Nature, 568(7751), 193-197.

+ Open protocol

+ Expand

4sU Labeled RNA Purification Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was first extracted using Qiazol lysis reagent (Qiagen, 79306) following the manufacturer’s instructions. Total RNA (~300 μg per reaction) and chromatin-associated RNA (~50–60 μg per reaction) were subjected to 4sU labeled RNA purification as previously described (Dölken et al., 2008 (link); Schwalb et al., 2016 (link)). In brief, labeled RNA (1 μg / 10 μl) was incubated with 10% biotinylation buffer (100mM Tris pH 7.5, 10mM EDTA) and 20% EZ-Link Biotin-HPDP (1 mg/mL resuspended in DMF, Thermo Fisher Scientific, 21341) for 1.5 hours at 800 rpm and 24°C in the dark. RNA was purified by mixing with a 1:1 ratio by volume of chloroform/isoamylacohol (24:1), separating with a phase-lock tube at 16,000 g for 5 min, and performing isopropanol precipitation. Biotinylated RNA separation was performed using the μMACS streptavidin kit (Miltenyi Biotec, 130-074-101). RNA was mixed with μMACS streptavidin beads at a 2:1 ratio by volume at 800 rpm and 24°C for 15 min. RNA-streptavidin beads mix was transferred to the μMACS column and washed with wash buffer (100 mM Tris pH 7.5, 10 mM EDTA, 1 M NaCl, 0.1% Tween 20) at 65°C and room temperature each 3 times. Selected RNA was eluted off the magnet with 0.1M DTT and purified using the miRNeasy micro kit (Qiagen, 217084) with on-column DNase I treatment (Qiagen, 79254).

Drexler H.L., Choquet K, & Churchman L.S. (2019). Splicing kinetics and coordination revealed by direct nascent RNA sequencing through nanopores. Molecular cell, 77(5), 985-998.e8.

+ Open protocol

+ Expand

Biotinylated RNA Purification via μMacs Streptavidin

Check if the same lab product or an alternative is used in the 5 most similar protocols

Biotinylated, TU-tagged RNA was purified using μMacs Streptavidin kit (Miltenyi Biotec – 130-074-101). The biotinylated RNA sample volume was adjusted to 50 μl with RNase-free water, heated to 65 °C for 2 min, and then placed on ice. The sample volume was adjusted to 100 μl with MPG buffer (100 mM Tris–HCl pH7.4, 10 mM EDTA pH8, 1 M NaCl, 0.02 % Tween-20) and incubated for 5 min at room temperature with 100 μl μMacs streptavidin beads. Beads were washed once with 100 μl of 65 °C MPG buffer, followed by 3 washes with 100 μl room temperature MPG. TU-tagged RNA was eluted from the beads with 2 × 100 μl 65 °C 100 mM DTT. The combined 200 μl sample was cleaned up and concentrated using the Qiagen RNeasy MinElute cleanup kit (Qiagen – 74204), thereby comprising the “TU-tagged” RNA sample.

Erickson T, & Nicolson T. (2015). Identification of sensory hair-cell transcripts by thiouracil-tagging in zebrafish. BMC Genomics, 16, 842.

+ Open protocol

+ Expand

4sU-RNA-seq Protocol for Transcriptome Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

4sU-RNA-seq was performed as described in Rabani et al.^{60 (link)}. In brief, cells were incubated with the medium supplemented with 500 μM 4sU for 15 min, after which medium was rapidly removed and cells were lysed with 5 mL of Trizol reagent (Life Technologies). Total RNA was treated with Ambion DNA-free DNase Treatment kit (Life Technologies) and resuspended in water. For each μg of total RNA, 2 μL of Biotin-HPDP (Pierce, 50 mg EZ-Link Biotin-HPDP) dissolved in DMF at a concentration of 1 mg/mL, and 1 μL of 10X Biotinylation buffer (100 mM Tris-HCl, pH 7.4, 10 mM EDTA), was added. After incubation for 15 min at 25 °C, the RNA was purified using two rounds of chloroform purification in Phase Lock Gel Heavy Tubes (Eppendorf), precipitation with an equal volume of isopropanol and 1/10 volume of 5 M NaCl, and finally resuspended in water.
Biotinylated 4sU-RNA was recovered using the μMacs Streptavidin Kit (Miltenyi). Per microgram of recovered biotinylated 4sU-RNA, 0.5 μL of streptavidin beads were added, in a total volume of 200 μL. Samples were washed six times, eluted in fresh 100 mM DTT, and further purified using the RNA Clean & Concentrator-5 kit (Zymoresearch). Libraries for RNA-seq were constructed using NEBNext^® Ultra^™ II Directional RNA Library Prep Kit for Illumina^®.

Zhang T., Wei G., Millard C.J., Fischer R., Konietzny R., Kessler B.M., Schwabe J.W, & Brockdorff N. (2018). A variant NuRD complex containing PWWP2A/B excludes MBD2/3 to regulate transcription at active genes. Nature Communications, 9, 3798.

+ Open protocol

+ Expand

Sponge-Mediated microRNA Pulldown Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

According to the manufacturer’s instructions, the RNA pulldown assay was performed using the μMACS Streptavidin Kit (Miltenyi Biotec Inc). We labelled sponge probe with biotin using transcription and then incubated the probes with an MCF-7 cytoplasmic lysate to form sponge-microRNA complexes. The complexes were combined via chain affinity with magnetic beads and thus separated from other components. After complex elution, we determined by qRT-PCR assays the miR-221/222 cluster that were pulled down. Briefly, total RNA (30 μg) and biotinylated capture DNA (1 μg) were used for pulldown. Then, 300 ng pulldown RNA was analyzed by real-time RT-PCR.

Ouyang Y.X., Feng J., Wang Z., Zhang G.J, & Chen M. (2021). miR-221/222 sponge abrogates tamoxifen resistance in ER-positive breast cancer cells through restoring the expression of ERα. Molecular Biomedicine, 2, 20.

+ Open protocol

+ Expand

Capturing RNA-Binding Factors Using MACS

Check if the same lab product or an alternative is used in the 5 most similar protocols

The μMACS Streptavidin kit (MACS Miltenyi Biotec, Bergisch Gladbach, Germany) was used to capture RNA‐binding factors as described by Rawcliffe et al., 2016. ISCU oligos representing normal and mutated ISCU were used, where the mutated sequence has a C instead of a G, (5′–[Biotin]AGCUCCAAUCUUUC/GAUUUCAGAAUCUG–3′). A scrambled RNA oligo was used as a negative control (5′– [Biotin]AUCGUGGAUAUAGCAGCGUACUAGUAG–3′). In brief, the binding reaction, including myoblast nuclear extract, biotinylated RNA oligos, and streptavidin microbeads (MACS Miltenyi Biotec), was added to μMACS columns attached to a magnetic MACS multi‐stand (MACS Miltenyi Biotec). The column was washed and the bead‐captured nuclear factors were eluted with 150 μl PBS. For the western blot assay, the maximum volume of 33 μl of eluent was loaded into each well, while 60 μg of myoblast nuclear extract and 15 μg of RD4 nuclear extract were used as positive controls. All chemicals were purchased from Sigma‐Aldrich unless otherwise stated.

Rawcliffe D.F., Österman L., Nordin A, & Holmberg M. (2018). PTBP1 acts as a dominant repressor of the aberrant tissue‐specific splicing of ISCU in hereditary myopathy with lactic acidosis. Molecular Genetics & Genomic Medicine, 6(6), 887-897.

+ Open protocol

+ Expand

Metabolic Labeling and Isolation of Newly Transcribed RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Metabolic labeling and isolation of newly transcribed RNA was performed as reported previously (Rädle et al., 2013 ). In brief, 80% confluent HeLa Flp-In cells were mock-treated or treated with DMSO, 5 μM of 4-NQO, or 5 μM of 4-NQO and 250 nM of flavopiridol for 1 or 2 h before lysis. Thirty minutes prior to lysis, the cells were labeled with 4sU at a final cell culture medium concentration of 100 μM. RNA was extracted with TRI reagent (Sigma) and 150 μg of total RNA was used for biotinylation with EZ-Link Biotin-HPDP (Thermo Fisher Scientific) for 90 min at room temperature. Second round of RNA extraction was performed with chloroform-isopropanol. μMACS Streptavidin Kit (Miltenyi) was used for separation of labeled RNA, which was followed by elution with DTT and RNA extraction with isopropanol. Libraries from two biological replicates were prepared and sequenced by Beijing Genomics.

Bugai A., Quaresma A.J., Friedel C.C., Lenasi T., Düster R., Sibley C.R., Fujinaga K., Kukanja P., Hennig T., Blasius M., Geyer M., Ule J., Dölken L, & Barborič M. (2019). P-TEFb Activation by RBM7 Shapes a Pro-survival Transcriptional Response to Genotoxic Stress. Molecular Cell, 74(2), 254-267.e10.

+ Open protocol

+ Expand

Pulse-Labeling of Nascent RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

We used the protocol described by Dolken et al., and Schawnhausser et al. (40 (link),41 (link)) that is represented in the Figure 1A. Briefly, exponentially growing HUVEC cells were exposed to 21 or 1% oxygen for 8 h and pulse-labeled with 4-thiouridine (400 μM, 4sU, Sigma, T4509) during the last 2 h of treatment. After treatment, total cellular RNA was isolated from cells using TRI-reagent (Ambion, AM9738). Hundred microgram of total RNA was subjected to a biotinylation reaction to label the newly transcribed RNA containing the 4sU moiety (Pierce, EZ-Link Biotin-HPDP, 21341). Then, RNA was purified using Ultrapure TM Phenol:Chloroform:Isoamylalcohol (Invitrogen, 15593–031) and labeled RNA was isolated from the total RNA by affinity chromatography using streptavidin coated magnetic beads (μMacs Streptavidin Kit; Miltenyi, 130–074-101).

Tiana M., Acosta-Iborra B., Puente-Santamaría L., Hernansanz-Agustin P., Worsley-Hunt R., Masson N., García-Rio F., Mole D., Ratcliffe P., Wasserman W.W., Jimenez B, & del Peso L. (2017). The SIN3A histone deacetylase complex is required for a complete transcriptional response to hypoxia. Nucleic Acids Research, 46(1), 120-133.

+ Open protocol

+ Expand

Biotinylation and Purification of 4sU-labeled RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Biotinylation was performed using a protocol adapted by the Goodrich-Kugel Lab (CU-Boulder) from Garibaldi et al.^{81 (link)}. To biotinylate 4sU-labeled RNAs, we mixed 50–70 μg of total RNA with the biotinylation reaction buffer containing 10 mM HEPES pH 7.5, 1 mM EDTA, and 0.1 mg/mL biotin-MTSEA-XX in dimethylformamide (Biotium). Reaction was carried out for 30 min in the dark at room temperature and was followed by phenol–chloroform extraction and isopropanol precipitation. Streptavidin pulldown of biotinylated RNAs was performed using the μMACS streptavidin kit (Miltenyi Biotec) and RNAs were eluted with 100 mM DTT. Biotinylated RNAs were then precipitated in ethanol, resuspended in water, and frozen at − 20 °C. Typical yields were 2% of total RNA based on Qubit quantification. Biotinylation and pulldown were done in sample replicate pairs to reduce variability from the pulldown. The quality of purified RNA was assessed using a TapeStation (Agilent).

Lammer N.C., Ashraf H.M., Ugay D.A., Spencer S.L., Allen M.A., Batey R.T, & Wuttke D.S. (2023). RNA binding by the glucocorticoid receptor attenuates dexamethasone-induced gene activation. Scientific Reports, 13, 9385.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!