Anti cd133

Manufactured by Proteintech

Sourced in United States

Anti-CD133 is a laboratory research tool used to detect and study the CD133 protein, a cell surface marker commonly expressed on various types of stem cells and cancer stem cells. This antibody can be used in techniques such as flow cytometry, immunohistochemistry, and western blotting to identify and analyze CD133-positive cell populations.

Automatically generated - may contain errors

Lab products found in correlation

Anti cd44, by Proteintech (6 mentions) Anti e cadherin, by Proteintech (2 mentions) Anti sox2, by Proteintech (2 mentions) Anti nanog, by Santa Cruz Biotechnology (2 mentions) Anti nestin, by Santa Cruz Biotechnology (2 mentions) Anti β actin, by Merck Group (2 mentions) Anti sox2, by Santa Cruz Biotechnology (2 mentions) Moflo xdp cell sorter, by Beckman Coulter (1 mentions) Crystal violet, by Beyotime (1 mentions) Chemiluminescence system, by Bio-Rad (1 mentions) Pvdf membrane, by Merck Group (1 mentions) Bca protein quantification kit, by Beyotime (1 mentions) Anti phlpp2, by Abcam (1 mentions) Pmsf ripa, by Beyotime (1 mentions) Anti sox2, by Abcam (1 mentions) Anti caspase 3, by Abcam (1 mentions) Anti nanog, by Proteintech (1 mentions) Anti sox9, by Abcam (1 mentions) Anti stat3, by Proteintech (1 mentions) Anti socs2, by Abcam (1 mentions)

Spelling variants of this product

CD133 (41 citations) Anti-CD133 antibody (5 citations) Rabbit anti-CD133 (4 citations) Anti-TM (2 citations)

13 protocols using anti cd133

Evaluating Cell Invasion and Stemness

Check if the same lab product or an alternative is used in the 5 most similar protocols

For cell invasion experiments, 2x10 5 cells were seeded into the upper chamber of a Matrigel-coated Boyden chamber in serum-free DMEM. The lower chamber was supplemented with DMEM containing 20% FBS as a chemoattractant. The cells were incubating for 48 h and the chamber was fixed with 10% neutral formalin for >4 h. The cells were dyed with crystal violet (Beyotime). The cells were counted under a microscope (Olympus) and the cell number is expressed as the average number of the cells in each field.
Flow cytometric analysis. The GBC cells were incubated with the primary anti-CD44 (Cat. no. 15675-1-AP; Proteintech, Rosemont, IL, USA) or anti-CD133 (Cat. no. 18470-1-AP; Proteintech) for 30 min at room temperature. The cells were then subjected to flow cytometry using a MoFlo XDP cell sorter from Beckman Coulter (Indianapolis, IN, USA) according to the manufacturer's instructions.
The GBC-SD LKB1 or SGC-996 LKB1 and their control cells were incubated with the primary anti-CD44 (Cat. no. 15675-1-AP; Proteintech) or anti-CD133 (Cat. no. 18470-1-AP; Proteintech) for 30 min at room temperature. Flow cytometric analysis was performed using a MoFlo XDP cell sorter from Beckman Coulter according to the manufacturer's instructions.

Hu M.T., Wang J.H., Yu Y., Liu C., Li B., Cheng Q.B, & Jiang X.Q. (2018). Tumor suppressor LKB1 inhibits the progression of gallbladder carcinoma and predicts the prognosis of patients with this malignancy. International journal of oncology, 53(3).

+ Open protocol

+ Expand

Protein Expression Analysis in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Whole cells were lysed in cell lysate buffer (PMSF:RIPA=1:100, Beyotime, China), and protein concentrations were quantified with a BCA protein quantification kit (Beyotime, China). Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, Billerica, MA, USA). The membranes were blocked in fat-free milk and incubated with specific antibodies at 4 °C for 12 hours. The antibodies included anti-PHLPP2 (Abcam, USA), anti-CD133 (Proteintech, USA), anti-CD44 (CST, USA), anti-EPCAM (CST, USA), anti-Nrf2 (CST, USA), and anti-GAPDH (Hangzhou Xianzhi, China). Membranes were then incubated with secondary antibody (ZSGB-bio, China) and detected using a chemiluminescence system (Bio-Rad).

Yongfu X., He Z., Xujian H., Jiemei H., Gang Y., Lei Z, & Jingdong L. (2022). PLHPP2 inhibits the stemness of colorectal cancer by inactivating the Nrf2 signaling pathway. Journal of Cancer, 13(4), 1313-1323.

+ Open protocol

+ Expand

Western Blot Analysis of Stem Cell Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Proteins were resolved using 20% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), followed by transfer of separated proteins onto a nitrocellulose membrane. Non-specific antigens on the membrane were blocked by incubating the membrane in 1×TBST (Tris-buffered saline with 0.1% Tween-20) containing 5% non-fat skim milk at room temperature for 1 h. Afterward, the membrane was incubated overnight with primary antibodies at 4°C followed by incubation with the secondary antibody (goat anti-mouse or anti-rabbit IgG antibody) at room temperature for 1 h. The primary antibodies used was anti-caspase3 (Abcam, US, 1;500), anti-Bax (R&D system, US, 1:1000), anti-Bcl2 (Abcam, US, 1;500), anti-Sox2 (Abcam, US, 1:1000), anti-Sox9 (Abcam, US, 1:1000), anti-CD133 (Proteintech, US, 1;1000), anti-Nanog (Proteintech, US, 1:1000), anti-SOCS2 (Abcam, US, 1:1000), anti-SOCS5 (Abcam, US, 1:500), anti-PTPN1 (Proteintech, US, 1:2000), anti-PTPN11 (Proteintech, US, 1:500), anti-STAT3 (Proteintech, US, 1:1000) The immunoblots were developed using the BeyoECL kit (Beyotime, China) and Tanon 5200 system (Tanon, China).

Shi C., Yang J., Hu L., Liao B., Qiao L., Shen W., Xie F, & Zhu G. (2020). Glycochenodeoxycholic acid induces stemness and chemoresistance via the STAT3 signaling pathway in hepatocellular carcinoma cells. Aging (Albany NY), 12(15), 15546-15555.

+ Open protocol

+ Expand

Immunoblotting and RT-PCR for Rac GTPases

Check if the same lab product or an alternative is used in the 5 most similar protocols

For immunoblotting, cells were lysed with 1xSDS lysis buffer (1% SDS and 60 mM Tris-HCl pH6.8) and sonicated for 20 seconds. Sixty μg of lysates were then applied to SDS-PAGE for immunoblot analysis. The target proteins were detected by their specific antibodies, including anti-HA (Santa Cruz), anti-Rac1 (BD Biosciences), anti-Rac2, anti-Rac3 (Abcam), anti-phospho-STAT3 Tyr705, anti-STAT3, anti-phospho-ERK1/2 Thr202/Tyr204, anti-ERK1/2, anti-Sox2 (Cell Signaling), anti-CD133 (Proteintech), anti-HIF-2α and anti-VEGF (Novas).
For RT-PCR, cells were subjected to RNA extraction using Trizol^® (Invitrogen) according to the manufacturer's instructions. Two μg of total RNA were reverse transcribed by GoScript™ kit (Promega) and then 2 μl of cDNA were used for PCR reaction by GoTaq^®Green Master Mix (Promega). Forward primer sequence for detecting Rac1-3 is 5’- CCTGAGGTGCGGCACCACTG −3’, and reverse primer sequences for Rac1-3 are 5’- GCAGGCATTTTCTCTTCC-3’, 5’-GGCTGCAGGC GCGCTTCTG-3’, and 5’-CGGTGCACTTCTTCCCC GG-3’, respectively.

Lai Y.J., Tsai J.C., Tseng Y.T., Wu M.S., Liu W.S., Lam H.I., Yu J.H., Nozell S.E, & Benveniste E.N. (2017). Small G protein Rac GTPases regulate the maintenance of glioblastoma stem-like cells in vitro and in vivo. Oncotarget, 8(11), 18031-18049.

+ Open protocol

+ Expand

Western Blot Analysis of Stem Cell Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

The antibody Anti-BPTF for Western blot was purchased from Abcam (cat. ab72036, USA). The antibody Anti-TERT was purchased from Millipore (cat. # ABE2075, USA). The antibodies Anti-c-Kit (cat. #3308), Anti-EpCAM (cat. #2929), Anti-Cleaved Caspase-7 (cat. #8438), Anti-Cleaved Caspase-9 (cat. #7237) and Anti-Cleaved PARP (cat. #5625) were purchased from Cell Signaling Technology (Danvers, MA, USA). The antibodies Anti-GAPDH (cat. 10494–1-AP), Anti-β-actin (cat. 20536–1-AP), Anti-Bcl-2 (cat. 12789–1-AP), Anti-CD44 (cat.15675–1-AP) and Anti-CD133 (cat. 18470–1-AP) were purchased from Proteintech (Wuhan, China) The antibodies Anti-H3K4me3 (cat. abs136455) and Anti-H3K27me3 (cat. abs136461) were purchased from Absin Bioscience (China). The antibodies Anti-BPTF (cat. sc98404) and Anti-TERT (cat. sc7212) for IHC experiments were purchased from Santa Cruz (USA). The protein bands were detected by enhanced chemiluminescence according to the manufacturer's instructions.

Zhao X., Zheng F., Li Y., Hao J., Tang Z., Tian C., Yang Q., Zhu T., Diao C., Zhang C., Chen M., Hu S., Guo P., Zhang L., Liao Y., Yu W., Chen M., Zou L., Guo W, & Deng W. (2018). BPTF promotes hepatocellular carcinoma growth by modulating hTERT signaling and cancer stem cell traits. Redox Biology, 20, 427-441.

+ Open protocol

+ Expand

Evaluating Cancer Stem Cell Properties

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Cell-Light 5-ethynyl-2′-deoxyuridine (EdU) Apollo 488 in vitro kit (C10310-3) was purchased from RiboBio (Guangzhou, China). Oxaliplatin (OXA) was purchased from the Cancer Hospital of the Chinese Academy of Medical Sciences (Beijing, China). MTT was purchased from Sigma-Aldrich (St. Louis, MO, USA). Anti-GAPDH, anti-NANOG, anti-Snai1, anti-p38, and anti-p-p38 antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA). Anti-OCT4, anti-SOX2, anti-ZO1, anti-E-cadherin, anti-CD133, and anti-Ki67 antibodies were purchased from Proteintech Group, Inc. (Rosemont, IL, USA). Anti-S100A8 antibodies were purchased from Beyotime (Nantong, China).

Zhou H., Chen M., Zhao C., Shao R., Xu Y, & Zhao W. (2024). The Natural Product Secoemestrin C Inhibits Colorectal Cancer Stem Cells via p38–S100A8 Feed-Forward Regulatory Loop. Cells, 13(7), 620.

+ Open protocol

+ Expand

Comprehensive Protein Expression Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Western blot analysis was performed as described previously.³⁷ (link) Band intensity quantification was performed using ImageJ software.³⁸ (link) Primary antibodies were as follows: anti-β3-tubulin, anti-Sox2, anti-Nestin, anti-EphA2, anti-GFAP, anti-Nanog, anti-OLIG2 (Santa Cruz Biotechnology, MA, USA), anti-β actin (Sigma-Aldrich), and anti-CD133 (Proteintech, Manchester, UK). Secondary antibodies were goat anti-rabbit and anti-mouse immunoglobulin G (IgG) (from Santa Cruz Biotechnology).

Affinito A., Quintavalle C., Esposito C.L., Roscigno G., Giordano C., Nuzzo S., Ricci-Vitiani L., Scognamiglio I., Minic Z., Pallini R., Berezovski M.V., de Francisis V, & Condorelli G. (2020). Targeting Ephrin Receptor Tyrosine Kinase A2 with a Selective Aptamer for Glioblastoma Stem Cells. Molecular Therapy. Nucleic Acids, 20, 176-185.

+ Open protocol

+ Expand

Immunofluorescence Staining for Glioma Stem Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Immunofluorescence staining was performed following a standard protocol. Briefly, adhered cells were fixed with 4% paraformaldehyde (PFA) for 30 min at room temperature. Subsequently, the samples were permeabilized in 0.5% Triton X-100 and blocked in 5% blocking buffer for 1 h. The cells were then incubated at 4 °C overnight with specific primary antibody (anti-vimentin, anti-FZD7). After washing with PBS three times, the cells were incubated with fluorescence-conjugated secondary antibody (Proteintech) for 1 h and stained with DAPI (4′ 6-diamidino-2-phenylindole) for 10 min, and viewed under a fluorescence microscope.
For GSC identification, tumor spheres were placed on poly-L-ornithine (BD Biosciences)-coated glass coverslips, incubated with anti-CD133 (1:100, Proteintech), and stained with Cy3-conjugated secondary antibody (Proteintech). For the differentiation assay, tumor spheres were seeded in a 24-well plate and cultured in medium supplemented with 10% FBS for 5 days. Differentiated cells were incubated with anti-GFAP (glial fibrillary acidic protein) antibody (1:100, Proteintech), stained with Cy3-conjugated secondary antibody (Proteintech), and counterstained with DAPI.

Liu Q., Guan Y., Li Z., Wang Y., Liu Y., Cui R, & Wang Y. (2019). miR-504 suppresses mesenchymal phenotype of glioblastoma by directly targeting the FZD7-mediated Wnt–β-catenin pathway. Journal of Experimental & Clinical Cancer Research : CR, 38, 358.

+ Open protocol

+ Expand

Probing Pluripotency and Stem Cell Markers

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were washed twice in ice-cold PBS and then lysed in JS buffer (50 mM HEPES, pH 7.5, containing 150 mM NaCl, 1% glycerol, 1% Triton X-100, 1.5 mM MgCl₂, 5 mM EGTA, 1 mM Na₃VO₄, and 1X protease inhibitor cocktail) as described [29 (link)]. Protein concentration was determined with a Bradford assay (Bio-Rad, Milan, Italy) using bovine serum albumin as standard; equal amounts of proteins were resolved on SDS-PAGE (10% acrylamide), electroblotted onto nitrocellulose membranes (G&E Healthcare, Milan, Italy), blocked for 1 h with 5% non-fat dry milk in Tris-buffered saline (TBS) containing 0.1% Tween-20, and incubated at 4°C overnight with primary antibody. Detection was performed by peroxidase-conjugated secondary antibodies (Santa Cruz Biotechnology) using enhanced chemiluminescence (EuroClone, Milan Italy). Primary antibodies were: anti-OCT3/4, anti-SOX2, anti-NANOG, anti-NESTIN (all from Santa Cruz Biotechnology), anti-EZH2, anti- β-catenin (from Cell Signaling Technology, EuroClone), anti-CD133 (Proteintech, Rosemont, IL, USA), anti-RYK (Genetex, CA, USA), and anti-β-actin (Sigma-Adrich).

Adamo A., Fiore D., De Martino F., Roscigno G., Affinito A., Donnarumma E., Puoti I., Vitiani L.R., Pallini R., Quintavalle C, & Condorelli G. (2017). RYK promotes the stemness of glioblastoma cells via the WNT/β-catenin pathway. Oncotarget, 8(8), 13476-13487.

+ Open protocol

+ Expand

Immunohistochemical Analysis of Piezo1, CD133, and CD44

Check if the same lab product or an alternative is used in the 5 most similar protocols

Immunohistochemistry was performed as previously described [21 (link)]. Tissue slides were incubated with anti-Piezo1 (1:200; Proteintech), anti-CD133 (1:200; Proteintech), or anti-CD44 (1:200; Proteintech) antibodies at 4 °C in a humidified chamber. The color was developed using the GTVision III Detection System/Mo&Rb Kit (Gene Tech). The widely accepted German semi-quantitative scoring system was used to assess the staining intensity and proportion of stained cells. Each specimen was assigned a score according to the intensity of staining (0, none; 1, weak; 2, moderate; 3, strong) and the proportion of stained cells (0, 0%; 1, 1–24%; 2, 25–49%; 3, 50–74%; 4, 75–100%). The final immune reactive score was determined by multiplying the intensity score by the percentage score, ranging from 0 to 12.

Li R., Wang D., Li H., Lei X., Liao W, & Liu X.Y. (2023). Identification of Piezo1 as a potential target for therapy of colon cancer stem-like cells. Discover. Oncology, 14, 95.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!