Mirneasy plasma kit

Total RNA from plasma containing small RNA was extracted using the miRNeasy Plasma Kit (Qiagen GmbH, Hilden, Germany). The concentration and purity of the RNA were determined with a NanoDrop 1000 (Thermo Fisher Scientific, Wilmington, DE). After the synthetization of cDNA using miScript II RT Kit with abidance by the manufacturer's protocol, the performance of qRT-PCR was done by miScript SYBR Green PCR Kit (Qiagen) on a Bio-Rad IQ5 Multicolor RT-PCR Detection System (Bio-Rad, Hercules, CA, USA). The relative levels of miR-340 (Forward: 5′-GCGCGTCCGTCTCAGTTACTT-3′; Reverse: 5′-AGTGCAGGGTCCGAGGTATT-3′) and miR-450b-5p (Forward: 5′-CGCGTTTTGCAATATGTTCC-3′; Reverse: 5′- AGTGCAGGGTCCGAGGTATT-3′) were calculated via the 2^-ΔΔCt method [20 (link)] using miR-16-5p (Forward: 5′-CGCGTAGCAGCACGTAAATA-3′; Reverse: 5′- AGTGCAGGGTCCGAGGTATT-3′) as reference gene, which has been reported to be a marker of hemolysis for its high and stable in the test environment [11 (link), 21 (link)].

Total RNA in plasma was isolated by the use of miRNeasy Plasma Kit (QIAGEN, Hilden, Germany) following the manufacturer's instructions. In detail, 200 μL EDTA-containing plasma was mixed thoroughly with 1000 μL QIAzol in RNase-free tube, incubated for 5 minutes at room temperature (15~25°C). To normalize for the plasma miRNA content, we supplemented 3.5 μL (1.6 × 10⁸ copies/μL) Caenorhabditis elegans miR-39 (cel-miR-39) to the samples (after addition of QIAzol) [19 (link)]. After mixing thoroughly, 200 μL of chloroform was added into the mix. Following vigorous vortex mix for 15 seconds, the tube containing the lysate was placed at room temperature for 2~3 minutes and then centrifuged for 15 minutes at 12000×g at 4°C. Later, the aqueous phase containing the RNA was carefully removed.

Total RNA in plasma was isolated using miRNeasy Plasma Kit (QIAGEN, Germany) following the manufacturer's instructions. First-strand cDNA was synthesized using PrimeScript RT reagent kit (Takara, Japan) from 2 μL of total RNA. Quantitative real-time PCR was performed using the StepOnePlus system (Applied Biosystems, America) with SYBR Premix Ex Taq (Takara, Japan). The stem-loop reverse transcription primers and PCR primers for the miRNA-155 (mature miRNA sequence UUAAUGCUAAUCGUGAUAGGGGUU) of interest were purchased from Ribobio (Guangzhou, China). The miRNA-155 expression values were normalized to snRNA U6 expression and were calculated using the 2^–ΔΔCt relative quantification method.

To harvest cell-free plasma, 3 mL of whole blood samples were centrifuged twice at 1200 g for 10 min at room temperature and the supernatant plasma was quickly removed and stored at −80 °C until further processing. The miRNeasy Plasma Kit (Qiagen, Hilden, Germany) was used to extract miRNAs from plasma samples. The Quantus™ Fluorometer, in combination with the Invitrogen microRNA Assay Kit (E5150-Quantus Fluorometer Promega, Madison, Wisconsin, USA), was used to measure low levels of miRNA in the plasma. The assay quantifies miRNA in solution at a final assay concentration of 0.05–100 ng/µL. Additionally, the confirmation of successful miRNA extraction was indicated by a bright 5S band by gel electrophoresis that signified successful extraction of miRNA.

RNA was extracted from 200 μL of plasma using the miRNeasy plasma kit (Qiagen), following the manufacturer’s instructions. As part of the standard protocol, each sample was spiked-in with 5.6 × 10⁸ copies of synthetic cel-miR-39-3p (Qiagen), which was used for quality control purposes in the PCR array experiment described below. RNA was eluted to a final volume of 12 μL in RNase-free water.

Venous blood samples were obtained via antecubital venipuncture. Whole blood (5 mL) was collected in EDTA-containing tubes and then centrifuged (12,000 ×g for 10 min at 4°C). Supernatant was collected and centrifuged (12,000 ×g for 10 min at 4°C). Plasma was obtained and was rapidly subjected to RNA extraction. miRNA in plasma was isolated by the use of miRNeasy Plasma Kit (Qiagen, Hilden, Germany) in accordance with the manufacturer's protocol.

Anticoagulated blood (K3-EDTA) was collected from patients prior to EUS-FNA or surgery. Plasma was obtained by standard gradient centrifugation and then immediately frozen at −80°C until required. RNA was isolated from the plasma using the miRNeasy Plasma Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. The resulting RNA was evaluated and quantified by spectrophotometry using NanoDrop ND-2000 (ThermoFisher). MiR-21 and miR-155 were measured by qRT-PCR as above. We used small nuclear RNA U6 as an endogenous control [35 ]. We did evaluate other published endogenous controls, such as miR-16 and miR-425-5p [34 (link)], but these exhibited greater inter-sample variability than U6.