Log In Sign up
The largest database of trusted experimental protocols

Anti phospho tyrosine 705 stat3

Manufactured by Cell Signaling Technology
Visit Supplier
Sourced in United States

Anti-phospho-tyrosine(705)-STAT3 is a primary antibody that recognizes the STAT3 protein when phosphorylated at tyrosine 705. This antibody can be used to detect and quantify the level of STAT3 phosphorylation in various samples.

Automatically generated - may contain errors

Lab products found in correlation

Anti stat3, by Cell Signaling Technology (3 mentions) Pvdf membrane, by Merck Group (2 mentions) Ecl detection kit, by GE Healthcare (2 mentions) Anti phospho serine 727 stat3, by Cell Signaling Technology (2 mentions) Hrp cojugated donkey anti rabbit or hrp conjuaged anti mouse antibody, by Thermo Fisher Scientific (2 mentions) Trizol, by Thermo Fisher Scientific (1 mentions) Anti stat5, by Cell Signaling Technology (1 mentions) Anti mmp2, by Cell Signaling Technology (1 mentions) Abi 7500 cycler, by Thermo Fisher Scientific (1 mentions) Brilliant sybr green mastermix kit, by Thermo Fisher Scientific (1 mentions) Ariamx real time pcr system, by Agilent Technologies (1 mentions)

Spelling variants of this product

STAT3 (1075 citations) Anti-STAT3 (536 citations) Phospho-STAT3 (345 citations) Anti-phospho-STAT3 (149 citations) Anti-phospho-tyrosine (15 citations) Phospho-tyrosine (15 citations) Phospho-tyrosine-STAT3 (2 citations)

3 protocols using anti phospho tyrosine 705 stat3

1

Quantitative Gene and Protein Expression Analysis in Murine Hearts

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from adult murine hearts was isolated with Trizol (Invitrogen) and cDNA synthesis was performed as described previously.21 (link),22 (link) Real-time PCR with SYBR green dye method (Brilliant SYBR Green Mastermix-Kit, Thermo Fisher) was performed with the AriaMx Real-Time PCR System (Agilent Technologies) as described.21 (link),22 (link) List of qRT-PCR primers used in this study is provided below. Expression of mature miR-146a was determined using miR-qRT-PCR on an ABI7500 cycler (Applied Biosystems, Foster City, USA) and was normalized using the 2-ΔΔCT method relative to U6 as described.23 (link)

Sequences of qRT-PCR primers

mRNASense primers (5’ to 3’)Antisense primers (5’ to 3’)
mmu 18SGTAACCCGTTGAA CCCCATTCCATCCAATCGGTA GTAGCG
mmu ANPGCCGGTAGAAGA TGAGGTCAGGGCTCCAATCCT GTCAATC
mmu α-MHCGGAAGAGCGAGC GGCGCATCAAGGGTCTGCTGGAGAGGT TATTCCTCG
mmu β-MHCCAAGTTCCGCA AGGTGCAAATTGCTTTATTCTG CTTCCAC
mmu Col1a1ACAGACGAACAAC CCAAACTGGTTTTTGGTCACG TTCAGT
Protein expression levels were determined by Western blotting, using SDS-PAGE as previously described.20 (link) The following antibodies were used: Anti-ErbB2, anti-ErbB4, anti-MMP2, anti-phospho-Tyrosine 705-STAT3, anti-STAT3, anti-phospho-Tyrosine 694 STAT5 and anti-STAT5 (Cell Signalling Technology), anti-MMP3 and anti-MMP9 (Abcam).
Nonhoff J., Ricke-Hoch M., Mueller M., Stapel B., Pfeffer T., Kasten M., Scherr M., von Kaisenberg C., Bauersachs J., Haghikia A, & Hilfiker-Kleiner D. (2017). Serelaxin treatment promotes adaptive hypertrophy but does not prevent heart failure in experimental peripartum cardiomyopathy. Cardiovascular Research, 113(6), 598-608.
+ Open protocol
+ Expand
2

STAT3 Activation in TH17 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
B6 CD4+ T cells were cultured under TH17 polarizing conditions for 5 d in presence of anti-CD3 and irradiated, T cell-depleted splenocytes. Following Ficoll separation to isolate viable cells, T cells were rested in neutral media and restimulated with IL-6 (20 ng/ml), IL-1β (20 ng/mL) or IL-21 (20 ng/ml) for the indicated times. Cell lysates were prepared in lysis buffer (RIPA buffer; 50 mM Tris-HCl pH?, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS) containing a protease & phosphatase inhibitor mixture (Pierce). Protein was quantified by Bradford Assay before equivalent amounts were separated by SDS-PAGE and transferred to a PVDF membrane (Millipore). Primary antibodies were: anti-STAT3 (Cell Signaling #9132), anti-phospho-tyrosine(705)-STAT3 (Cell signaling Technology #9145), or anti-phospho-serine(727)-STAT3 (Cell signaling Technology #9134). HRP-cojugated Donkey anti-rabbit or HRP-conjuaged anti-mouse antibody (Affinity Bioreagents) were used to detect target protein by ECL detection kit (GE Healthcare or Pierce SuperSignal Dura).
Basu R., Whitley S.K., Bhaumik S., Zindl C.L., Schoeb T.R., Benveniste E.N., Pear W.S., Hatton R.D, & Weaver C.T. (2015). IL-1 signaling modulates STAT activation to antagonize retinoic acid signaling and control Th17–iTreg balance. Nature immunology, 16(3), 286-295.
+ Open protocol
+ Expand
3

STAT3 Activation in TH17 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
B6 CD4+ T cells were cultured under TH17 polarizing conditions for 5 d in presence of anti-CD3 and irradiated, T cell-depleted splenocytes. Following Ficoll separation to isolate viable cells, T cells were rested in neutral media and restimulated with IL-6 (20 ng/ml), IL-1β (20 ng/mL) or IL-21 (20 ng/ml) for the indicated times. Cell lysates were prepared in lysis buffer (RIPA buffer; 50 mM Tris-HCl pH?, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS) containing a protease & phosphatase inhibitor mixture (Pierce). Protein was quantified by Bradford Assay before equivalent amounts were separated by SDS-PAGE and transferred to a PVDF membrane (Millipore). Primary antibodies were: anti-STAT3 (Cell Signaling #9132), anti-phospho-tyrosine(705)-STAT3 (Cell signaling Technology #9145), or anti-phospho-serine(727)-STAT3 (Cell signaling Technology #9134). HRP-cojugated Donkey anti-rabbit or HRP-conjuaged anti-mouse antibody (Affinity Bioreagents) were used to detect target protein by ECL detection kit (GE Healthcare or Pierce SuperSignal Dura).
Basu R., Whitley S.K., Bhaumik S., Zindl C.L., Schoeb T.R., Benveniste E.N., Pear W.S., Hatton R.D, & Weaver C.T. (2015). IL-1 signaling modulates STAT activation to antagonize retinoic acid signaling and control Th17–iTreg balance. Nature immunology, 16(3), 286-295.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!